ID: 1160157173

View in Genome Browser
Species Human (GRCh38)
Location 18:76442695-76442717
Sequence GCTCTTGGTGGGGCTGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 624}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160157161_1160157173 8 Left 1160157161 18:76442664-76442686 CCCCGTTCAGCAGCCGGTTGCAG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624
1160157166_1160157173 -5 Left 1160157166 18:76442677-76442699 CCGGTTGCAGGCCGAGGCGCTCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624
1160157158_1160157173 24 Left 1160157158 18:76442648-76442670 CCGTCGGCCTGCGAGGCCCCGTT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624
1160157162_1160157173 7 Left 1160157162 18:76442665-76442687 CCCGTTCAGCAGCCGGTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624
1160157164_1160157173 6 Left 1160157164 18:76442666-76442688 CCGTTCAGCAGCCGGTTGCAGGC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624
1160157159_1160157173 17 Left 1160157159 18:76442655-76442677 CCTGCGAGGCCCCGTTCAGCAGC 0: 1
1: 0
2: 1
3: 12
4: 93
Right 1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG 0: 1
1: 0
2: 6
3: 30
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160157173 Original CRISPR GCTCTTGGTGGGGCTGGCGC AGG Exonic
900208084 1:1440009-1440031 GCTCTGGGCGGGGATGGGGCCGG - Exonic
900243384 1:1627138-1627160 GCTGGTGGTGGAGGTGGCGCTGG + Exonic
900321690 1:2087725-2087747 CCTTTTGGTGGGGGTGGCGGGGG + Intronic
900354108 1:2251638-2251660 GCATCTGGGGGGGCTGGCGCCGG + Intronic
900480125 1:2894180-2894202 GCTCATGGTGGAGCAGCCGCTGG - Intergenic
900627972 1:3618119-3618141 GGCCTTGCTGGGGATGGCGCCGG - Intergenic
900981260 1:6047573-6047595 GCTGTTGGTGGGGGCGGGGCTGG - Intronic
900981611 1:6049148-6049170 GCTGTTGGTGGGGGCGGGGCTGG - Intronic
901045522 1:6393494-6393516 GCTCGGGGTGGGGCCGGCGCGGG - Intronic
901371680 1:8803806-8803828 GCACTTTGTGGGGCTGAGGCAGG - Intronic
901573375 1:10180067-10180089 GCTCTGGGTGGGCCTGGGGTTGG - Exonic
901638826 1:10682883-10682905 GCGCTTGGTGTGGCTGGGCCGGG + Intronic
902544692 1:17182821-17182843 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
903037269 1:20501013-20501035 GCTCTGGAAGGTGCTGGCGCTGG - Exonic
903131226 1:21280662-21280684 GCTGTTGGTGGGGCCGTTGCAGG - Intronic
904302272 1:29561928-29561950 GCCCTGGGTGGAGCTGGCACAGG + Intergenic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904401148 1:30257580-30257602 GCCCTGGGTGGAGCTGGCACAGG - Intergenic
904502710 1:30925135-30925157 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
905106307 1:35565540-35565562 TGTCCTGGTGGAGCTGGCGCGGG + Exonic
905439261 1:37983472-37983494 GTACTTGGTGGGGCTGAGGCGGG + Intronic
906037611 1:42761772-42761794 GCTATTTGTGGGGCTGAGGCGGG + Intronic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
907993763 1:59608584-59608606 GCACTTTGTGAGGCTGGGGCGGG + Intronic
909024657 1:70468323-70468345 GGTGCTGGTGGGGCTGGGGCTGG - Intergenic
910579371 1:88805934-88805956 GCTCGTGGTGGGGCTGGAGGAGG - Exonic
911236608 1:95418979-95419001 GCTCTTAGTGGGACTGGTGGAGG + Intergenic
912993501 1:114511151-114511173 GCTCTTGCTGCGGCTGCGGCTGG - Exonic
914852353 1:151324480-151324502 GATCCTGGTAGGGCTGGAGCTGG - Intronic
915121455 1:153631955-153631977 GCCCTTGGTGGGGGTGGGGGTGG - Exonic
915288896 1:154869816-154869838 GCTGCTGGTGGCGCTGGCGGTGG + Exonic
915332252 1:155120317-155120339 GCTCTGACTGGGGCTGGGGCAGG - Intergenic
915378481 1:155419152-155419174 GCACTTTGTGTGGCTGACGCAGG + Intronic
916146699 1:161746323-161746345 GCACTTTGTGGGGCTGAGGCTGG - Intergenic
917755491 1:178094086-178094108 GCTCTGGCTGGGGATGGAGCGGG - Intergenic
919634066 1:199987081-199987103 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
920091300 1:203455148-203455170 GCCCTTGGTGGGTTTGGGGCAGG - Intergenic
920097645 1:203497005-203497027 GCTCTTGGCGGGACTGATGCTGG - Exonic
921203576 1:212829082-212829104 GCACTTTGTGGGGCTGAGGCGGG + Intergenic
922699648 1:227751292-227751314 ACAGGTGGTGGGGCTGGCGCAGG - Intronic
923395362 1:233556656-233556678 GCACTTCGTGGGGCTGAGGCTGG - Intergenic
924052519 1:240092748-240092770 GCTGTTGCTGGAGCTGGAGCTGG - Exonic
924120809 1:240796031-240796053 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1062788721 10:287193-287215 GCACTTTGTGGGGCTGAGGCTGG - Intronic
1063021986 10:2137971-2137993 GCACTTGGAGCGGCTGGCTCTGG - Intergenic
1063781285 10:9328116-9328138 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
1065783602 10:29192895-29192917 GCGCTTTGTGGGGCTGAAGCAGG + Intergenic
1067213066 10:44277984-44278006 GCACTTTGTGGGGCTGAGGCGGG - Intergenic
1068079733 10:52305564-52305586 GTTCTTTGTGAGGCTGGGGCAGG + Intergenic
1068432730 10:56953595-56953617 GCTCTTTGTGAGGCTGAGGCAGG + Intergenic
1069594673 10:69663019-69663041 GCTCTTGGCTGGTCTGGCACGGG - Intergenic
1069598397 10:69687454-69687476 GGACATGGTGGGGCTGGGGCAGG - Intronic
1069787504 10:70998140-70998162 ACTCTCAGTGGGGCTGGGGCTGG + Intergenic
1069959845 10:72073190-72073212 CCTGGTGGTGGGGCTGGGGCTGG - Intronic
1070148671 10:73792298-73792320 GCACTGGGTGGGGCTGGCAGTGG + Exonic
1070366069 10:75738249-75738271 GCCTTTGGTGGGGCTGGTGCTGG + Intronic
1070600993 10:77866185-77866207 GTGCCTGGTGGGGCTGGCCCTGG - Intronic
1070732204 10:78838276-78838298 GCTCTTGGTGGGGCATGCCGTGG + Intergenic
1071504690 10:86225580-86225602 TGTCTAGGTGGGGCTGGAGCTGG - Intronic
1072102321 10:92240293-92240315 GCTGCTGCTGGGGCTGGGGCTGG + Exonic
1073214701 10:101829812-101829834 GCTCCTGGTGGGGGCGGGGCGGG - Intronic
1073251431 10:102122090-102122112 GCTCCTGGTGGGGGTGGAGATGG - Intergenic
1073306976 10:102510573-102510595 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1073330943 10:102669510-102669532 GCTCTAGGTGGGCCTGGGCCTGG + Intergenic
1073513462 10:104057100-104057122 GGTGTTGGTGGCGCTGGCGGCGG - Exonic
1075147536 10:119895135-119895157 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1075668803 10:124249054-124249076 GCCCTTGGTGAGGCTTGCGGGGG - Intergenic
1075777395 10:124997577-124997599 GCTCGTGTAGGGGCTGGCGTAGG - Intronic
1076110465 10:127855760-127855782 GCTCCTGCAGGGGCTGGAGCTGG + Intergenic
1076355318 10:129848343-129848365 GCTCATGGTGGGGCCGCCACTGG - Intronic
1076692374 10:132230446-132230468 GCGGGTGCTGGGGCTGGCGCAGG - Intronic
1076713585 10:132352285-132352307 CCTCCGGGTGGGGCAGGCGCAGG + Intronic
1076727713 10:132421263-132421285 GCTGGGGGTGGGGCTGGGGCCGG - Intergenic
1076947918 10:133664760-133664782 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076948908 10:133668070-133668092 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
1076949892 10:133671369-133671391 GTCCGTGGTGGGGCTGGGGCCGG + Intronic
1076950876 10:133674668-133674690 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076951866 10:133677978-133678000 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076952855 10:133681288-133681310 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076953839 10:133684587-133684609 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076954823 10:133740939-133740961 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076955812 10:133744249-133744271 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076956802 10:133747559-133747581 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076957789 10:133750868-133750890 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076958774 10:133754167-133754189 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076959763 10:133757477-133757499 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1076960747 10:133760776-133760798 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1077051195 11:567900-567922 CCGCTTGGTGGGGCTGAGGCTGG - Intergenic
1077121798 11:912204-912226 GCTCCTGGGGAGGCTGGGGCAGG + Intronic
1077168820 11:1157441-1157463 GCTTTGGATGGGGCTGGGGCTGG + Intergenic
1077181293 11:1218369-1218391 GCACCTGGTGTGGCTGGGGCTGG - Intergenic
1077211338 11:1372156-1372178 GCTCCACGTCGGGCTGGCGCCGG + Intergenic
1077309114 11:1880735-1880757 GCCCTTGGTGGGGGTGGCCAAGG - Intronic
1077342511 11:2032329-2032351 GCTCCCGGTGTGGCTGGCGTTGG + Intergenic
1077382414 11:2250316-2250338 CATCTTGGTGGTGCTGGTGCTGG - Intergenic
1077470839 11:2759838-2759860 GCTCAGGGTGGGGCTGGGCCTGG - Intronic
1077491599 11:2863233-2863255 GCTCCTGCTGGGGCTGGAGATGG - Intergenic
1080631752 11:34083819-34083841 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1081580307 11:44347258-44347280 CCTCTGGGTGGGGCTGGTCCTGG + Intergenic
1082028302 11:47588041-47588063 GCTCTGGGCTGGGCTGGAGCTGG + Exonic
1082034762 11:47636014-47636036 GCTCTTAGGGAGGCTGGGGCAGG + Intronic
1083253557 11:61482995-61483017 GGTAATGGTGGGGCTGGGGCAGG - Intronic
1083424200 11:62574587-62574609 GCCCCTGGAGGGGCTGACGCTGG + Exonic
1083640044 11:64140497-64140519 GCCCTTGGTGGGGCTGGGAACGG - Intronic
1083800300 11:65042651-65042673 GCTCTTTGGGAGGCTGACGCAGG - Intronic
1083813277 11:65117341-65117363 ACTCTGGGAGCGGCTGGCGCCGG - Exonic
1083889727 11:65589775-65589797 GCTGTGGGTGGGCCTGGGGCAGG - Exonic
1083960619 11:66012969-66012991 GCTCTGGGGAGGGCTGGGGCTGG - Intronic
1084139245 11:67213509-67213531 GCACTTTGTGGGGCTGAGGCTGG + Intronic
1084209893 11:67616035-67616057 GCTCTGGGTCGGGCTGCAGCTGG + Intergenic
1084265148 11:68001417-68001439 ACACTTTGTGGGGCTGGGGCGGG + Intronic
1084574989 11:69983294-69983316 GCTCTTGGTGAGGCCAGCACTGG - Intergenic
1085092945 11:73734370-73734392 GCTCTTTGGGGGGCTGAGGCAGG - Intronic
1085435977 11:76503052-76503074 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1085489744 11:76904241-76904263 GCACTTTGTGGGGCTGGGGCAGG - Intronic
1087293964 11:96347830-96347852 GCACTTTGTGAGGCTGGGGCGGG - Intergenic
1089174113 11:116536136-116536158 GCTAGGGGAGGGGCTGGCGCTGG + Intergenic
1089191905 11:116659758-116659780 GGGCTTGGTGGTGCTGGGGCAGG - Intergenic
1090297444 11:125601372-125601394 GCACTTTGTGAGGCTGGGGCAGG + Intronic
1090997515 11:131880261-131880283 GCCCTTGCTGGTGCTGGCTCTGG + Intronic
1091217922 11:133914895-133914917 GCCCCAGGTGGGGCTGGCGTTGG - Intronic
1202825497 11_KI270721v1_random:87518-87540 GCTCCCGGTGTGGCTGGCGTTGG + Intergenic
1091582033 12:1796129-1796151 GCTCTGGGTGAGGGTGGCGGGGG + Intronic
1091584333 12:1807372-1807394 GATCTGGGTGCGGCTGGCTCAGG - Intronic
1091598074 12:1893269-1893291 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1091784115 12:3231901-3231923 GCTCTCAGTGGGGCTGTCTCAGG + Intronic
1092030460 12:5279279-5279301 GATCTAGGTAGGGCTGGAGCTGG - Intergenic
1092412732 12:8266666-8266688 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1092810504 12:12267368-12267390 GCTCTTTGTGCGGCCGCCGCCGG + Intergenic
1093367173 12:18317255-18317277 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1093442117 12:19211348-19211370 GATCTTGGTGGGGAGGGCGGTGG + Intronic
1095741466 12:45611246-45611268 GCTGGCGCTGGGGCTGGCGCTGG + Intergenic
1095748890 12:45689456-45689478 GCTCTTGGGGAGGCTGAGGCAGG - Intergenic
1096068721 12:48761944-48761966 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1096796414 12:54080735-54080757 GCTCTTGGCGGGGCTGGGGTTGG - Intergenic
1096982441 12:55736211-55736233 GATCCTGGTGGGGGTGGGGCTGG - Intergenic
1097003342 12:55897063-55897085 GCACTTTGTGGGGCTGAGGCTGG + Intergenic
1099202286 12:79690631-79690653 GACCTTGGTGGGGATGGGGCGGG - Intronic
1099222912 12:79935250-79935272 GCTCTTCCTGGGGCGGGCACAGG - Intronic
1101175880 12:102151269-102151291 GGTCTGGGTGGGGGTGCCGCGGG + Intronic
1101466765 12:104957864-104957886 GCCCGAGGTGGGGCAGGCGCGGG + Intronic
1101968760 12:109298134-109298156 GCTGGTGGTGGGGATGGCGATGG - Intronic
1102492734 12:113298667-113298689 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
1103594820 12:122018214-122018236 GCTCTGGCTGGGGCTGGGGAAGG + Intergenic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104633799 12:130425438-130425460 GCTGTTGGTGGGGCCGGGGATGG - Intronic
1104678686 12:130733360-130733382 GCTACTGGAGGGGCTGGGGCAGG + Intergenic
1104745514 12:131207939-131207961 GATCTCAGTGGGGCTGGCTCAGG - Intergenic
1104788826 12:131469170-131469192 GATCTCAGTGGGGCTGGCTCAGG + Intergenic
1104944303 12:132408846-132408868 GCTCCGGGTGGTGCTGGCCCTGG - Intergenic
1105209394 13:18249013-18249035 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1105209402 13:18249031-18249053 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1105500821 13:20970360-20970382 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1105502992 13:20988742-20988764 GCTCTGCGGGGGGCTGTCGCTGG + Exonic
1106243535 13:27928229-27928251 ACGCTTGGTGGGGGTGGCGGAGG + Intergenic
1107032900 13:35871270-35871292 GCTCTTGGTGGTGCTCCTGCGGG + Exonic
1108365620 13:49709154-49709176 GCACTTTGTGGGGCTGAAGCAGG + Intronic
1108380554 13:49850216-49850238 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1108667545 13:52647808-52647830 GTTCTTGTTGGGGCTGAGGCAGG - Intergenic
1113085736 13:106567869-106567891 GCTCTTGGTGTGCTTGGAGCGGG + Exonic
1113371727 13:109731400-109731422 GGCCTTGCTGGGGCTGGGGCTGG - Intergenic
1114212077 14:20624039-20624061 GCACTTTGTGGGGCTGAGGCGGG + Intergenic
1114234598 14:20813159-20813181 GCTCTTAGAGGGGCTGGGGCAGG - Intergenic
1115250569 14:31342138-31342160 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1115396555 14:32915640-32915662 GCACTTGGGGAGGCTGACGCAGG + Intergenic
1115519756 14:34221533-34221555 GCTGTTGGTGGTGCTGGAGATGG + Intronic
1115528144 14:34301889-34301911 GCTAGGGGTGGGGCTGGGGCTGG - Intronic
1115545495 14:34462189-34462211 GCGCATGGCGGGGATGGCGCTGG - Exonic
1116810341 14:49533917-49533939 GCTACTAGTGGGGCTGACGCAGG + Intergenic
1118852332 14:69593511-69593533 TCTCTTGGGGGGGCTGACGGGGG - Intergenic
1119058267 14:71446453-71446475 GCTCTTTGTGAGGCTGAGGCAGG + Intronic
1119340716 14:73875242-73875264 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1121463945 14:94102299-94102321 GCTCTGGGAGGGGCTGCTGCAGG - Intronic
1121616834 14:95319370-95319392 GCTCTTGGGGGCGGTGGCCCAGG - Intronic
1121668694 14:95691826-95691848 GCCATTGGAGGGGCTGGCACTGG + Intronic
1122071726 14:99209468-99209490 GCTCTGGGCTGGGCTGGCCCTGG - Intronic
1122127803 14:99588553-99588575 GCTCCTGCTGGCGATGGCGCTGG + Intronic
1122136093 14:99633724-99633746 GTCCTTGCTGGGGCTGGAGCAGG + Intergenic
1122761701 14:104033527-104033549 GCCCTTGCTGGGGCTGCAGCAGG + Intronic
1122767375 14:104081695-104081717 GCTCTGGGTGGGGCTGGGGCCGG + Intergenic
1122857982 14:104569043-104569065 GCGCTGGGAGGGGCTGGTGCTGG - Intronic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1123029429 14:105444542-105444564 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1202849780 14_GL000225v1_random:9304-9326 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1202860586 14_GL000225v1_random:79119-79141 GTCCATGGTGGGGCTGGGGCCGG - Intergenic
1202922065 14_KI270723v1_random:35587-35609 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
1202922865 14_KI270724v1_random:2026-2048 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
1123912793 15:24985558-24985580 GCACTTTGTGGGGCTGAGGCGGG - Intergenic
1124054378 15:26228311-26228333 TCTCTTGGTGTGGCTGGGTCTGG + Intergenic
1125928750 15:43584577-43584599 GCTGTGGGTGGGGCTGGGGATGG + Intronic
1125941916 15:43684412-43684434 GCTGTGGGTGGGGCTGGGGATGG + Intergenic
1127052439 15:55098809-55098831 GCTATTCGTGGGGCTGAGGCAGG + Intergenic
1127482242 15:59388315-59388337 GCTACTTGTGGGGCTGGGGCAGG - Intronic
1127518033 15:59715095-59715117 GCACTTGGTGGGGCTGAGGTGGG + Intergenic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1127954654 15:63842810-63842832 GCACTTTGTGGGGCTGGGACAGG + Intergenic
1128234631 15:66059231-66059253 CCTCGTGGTGAGGATGGCGCGGG - Intronic
1128285744 15:66435572-66435594 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1130075603 15:80686617-80686639 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1130288710 15:82577767-82577789 GCACTTTGTGAGGCTGGGGCAGG - Intronic
1130436204 15:83902514-83902536 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1130959750 15:88652045-88652067 CTTCTGGGTGGGGCTGGGGCTGG - Intronic
1131110291 15:89760603-89760625 CGTCTTGGTGGGTCTGGAGCTGG + Intronic
1131250412 15:90826648-90826670 GTTCGTGGTGCGGCTGGCTCAGG - Intergenic
1131378838 15:91947379-91947401 GCTCTTGGTCTGGTTGCCGCTGG + Intronic
1131476546 15:92744918-92744940 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1132268197 15:100498003-100498025 GCTCTTCGTGAGGCTGAGGCAGG - Intronic
1132321912 15:100931629-100931651 TCTGCTGGTGGGGCTGGCGCGGG + Intronic
1132357915 15:101186555-101186577 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1132594760 16:743658-743680 GCTCCGGGTGGAGCTGGGGCGGG + Intronic
1132649540 16:1014272-1014294 GGTGTTGGCGGGGCTGGGGCTGG + Intergenic
1132720986 16:1315479-1315501 CCCCTTGGTGGGGCTGGTCCAGG + Intronic
1134172581 16:11979886-11979908 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1134850513 16:17474851-17474873 GCTGTTGCTAGGGCTGCCGCTGG - Intergenic
1135694075 16:24572153-24572175 GCTTCTGCTGGGGCTGACGCTGG - Exonic
1135732598 16:24907184-24907206 CCACTGGGTGGGGCTGGGGCAGG + Intronic
1136019454 16:27430701-27430723 GCTTTTTGTGGGGCTGAGGCGGG + Intronic
1136051482 16:27653768-27653790 GCTCTTCGGGAGGCTGACGCAGG - Intronic
1136296183 16:29304360-29304382 GCTCTTGGTGATGCTGGTGAAGG + Intergenic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1136685342 16:31990809-31990831 GCATTTTGTGGGGCTGGGGCAGG - Intergenic
1136785956 16:32934345-32934367 GCATTTTGTGGGGCTGGGGCAGG - Intergenic
1136883819 16:33919460-33919482 GCATTTTGTGGGGCTGGGGCAGG + Intergenic
1137578159 16:49617544-49617566 GGTCCTGGAGGGGCTGGCACTGG - Intronic
1138043165 16:53696945-53696967 GCACTTTGGGGGGCTGGGGCGGG + Intronic
1138375355 16:56559815-56559837 GCACTTTGTGGGGCTGAAGCGGG + Intergenic
1138390534 16:56667343-56667365 GCACTTGCAGGAGCTGGCGCAGG + Exonic
1139892642 16:70263746-70263768 GCTATTTGTGGGGCTGAGGCAGG - Intronic
1140521166 16:75582977-75582999 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1140753664 16:78048552-78048574 GGCCTTGGTGGAGCTGGAGCCGG + Intronic
1140786620 16:78348567-78348589 GCTACTGGTGGGGCTGAGGCAGG - Intronic
1141582740 16:85011388-85011410 GCTCATGGCCGGGCTGGAGCGGG + Exonic
1141699030 16:85634025-85634047 GCTGGTGGCGGGGCTGCCGCTGG - Exonic
1141927596 16:87179339-87179361 GCTGTTTGTGGGGGTGGGGCAGG - Intronic
1142010660 16:87712101-87712123 GCCCAAGGTGGGGCTGGTGCAGG - Intronic
1142178381 16:88655540-88655562 GGTCTTGGCGGGGCTGCCGCAGG + Intronic
1203088191 16_KI270728v1_random:1196005-1196027 GCATTTTGTGGGGCTGGGGCAGG - Intergenic
1142716663 17:1750805-1750827 GCTGTGGGTGAGGCTGGCCCGGG + Intronic
1143034084 17:3984534-3984556 GCTACTGGGGGGGCTGGGGCAGG - Intergenic
1143078782 17:4366371-4366393 GCTCTGGGGGCGGCTGGAGCGGG + Exonic
1143471498 17:7178558-7178580 GGTCATGATAGGGCTGGCGCTGG + Exonic
1143498482 17:7325584-7325606 GCTTTCGGTGGGGCTGGGACTGG - Intronic
1143514015 17:7410476-7410498 ACTCATGATGGGGCAGGCGCTGG - Intronic
1143661427 17:8326901-8326923 GCTCGCGGTGGAGCTGTCGCTGG - Intergenic
1143852878 17:9825842-9825864 GCTTTTGGGGGGGCAGGGGCGGG + Exonic
1143953005 17:10648309-10648331 CCTCTCTGTGGGGCTGGCACGGG - Intronic
1144272785 17:13634698-13634720 GCACTTTGTGGGGCTGAGGCGGG + Intergenic
1144547855 17:16215000-16215022 GCCCCGGGTGGGGCCGGCGCAGG - Intronic
1144651396 17:17009452-17009474 TTTCTTGGTGGGGCTGGTGGAGG - Intergenic
1144819448 17:18061342-18061364 GCTCTTGGAGGGGGTGTCACAGG + Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1145072846 17:19825738-19825760 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1145901648 17:28493995-28494017 GCTGTTGGTGGAGGGGGCGCGGG - Exonic
1145912212 17:28549331-28549353 GATATGGGTGGGGCTGGGGCAGG + Intronic
1146022703 17:29293110-29293132 GCTCTGGGGGGAGCGGGCGCGGG + Intronic
1147175001 17:38649948-38649970 GCACTTGGGGGGGCTGAGGCAGG - Intergenic
1147313151 17:39606746-39606768 GCTCTGGGCGGGGCAGGCGGCGG - Intronic
1147679018 17:42227615-42227637 GCTCCTGGAGGGCCTGGTGCAGG - Exonic
1147686644 17:42289914-42289936 GCTCCTGGAGGGCCTGGTGCAGG + Exonic
1148114745 17:45169117-45169139 GATCTTGCTGGGGCTGTCGGTGG + Exonic
1148436793 17:47691816-47691838 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1148513187 17:48190737-48190759 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1149581337 17:57752425-57752447 ACTCTGGGTGGGGCTGGGGTGGG - Intergenic
1149670761 17:58407324-58407346 GCACTTTGTGGGGCTAGGGCAGG - Intronic
1150061770 17:62074820-62074842 GCACTTTGAGGGGCTGGGGCAGG - Intergenic
1150828431 17:68496933-68496955 GCTATTTGTGGGGCTGAGGCAGG - Intergenic
1151299751 17:73215518-73215540 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1151371443 17:73648650-73648672 GCTGTAGGTGGGGCTGGGCCAGG + Intergenic
1151670335 17:75568712-75568734 GCTTGCGGTGGGGCTGGGGCTGG - Intronic
1151694335 17:75706451-75706473 GGTCTTGGAGCCGCTGGCGCTGG - Exonic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151956896 17:77384620-77384642 ACTCTTGGTGGTTCTGGCTCAGG - Intronic
1152026699 17:77814307-77814329 GCTGTTGGCTCGGCTGGCGCTGG - Intergenic
1152262266 17:79273564-79273586 GCTCTGGGGGGGGCGGGGGCGGG + Intronic
1152531689 17:80922782-80922804 CTTGTTGGTGGGGCTGGCGGGGG - Exonic
1152579643 17:81160310-81160332 GCCTTGGGTGGGGCTGGGGCGGG - Intronic
1153559090 18:6351930-6351952 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1153843851 18:9030964-9030986 GCTATTTGTGGGGCTGAGGCAGG + Intergenic
1153946524 18:10022886-10022908 GTTAATGGTGGGGCTGGTGCTGG + Intergenic
1153992172 18:10410319-10410341 GCTCATAGTGGGGCTGGCCAGGG - Intergenic
1155164633 18:23222295-23222317 GCTCTTAGTGGAGCTGGGGGTGG - Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1158327497 18:56326903-56326925 GGACTGGGTGGGGCTGGAGCTGG + Intergenic
1158473865 18:57762383-57762405 GCACTTCGGGGGGCTGACGCGGG - Intronic
1158752233 18:60275353-60275375 GCTACTAGTGGGGCTGACGCAGG - Intergenic
1158947488 18:62459566-62459588 GATCTCCGTGGGGCTGGGGCGGG + Intergenic
1159161238 18:64646059-64646081 GCTCTGGGTGAGGCTGCAGCTGG + Intergenic
1159657781 18:71053113-71053135 GCTCTTGATGATGCTGACGCTGG - Intergenic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1160579671 18:79876365-79876387 GCACTTGGTGGGGCTGGGCTGGG + Intronic
1160674546 19:382735-382757 GCTGTTGCTGGGGCTGTGGCAGG + Intergenic
1160807833 19:1000455-1000477 GCTGTGGCTGGGCCTGGCGCTGG + Exonic
1160933511 19:1582146-1582168 GCACTTGGCGGGGCTGGGGCAGG - Intronic
1161329961 19:3682017-3682039 GCTATTGGTGGGGGTGGTGACGG - Intronic
1161368730 19:3896886-3896908 GCTATTGGTGAGGCTGAGGCAGG - Intronic
1161541939 19:4857189-4857211 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1161766040 19:6209495-6209517 CCTCTGGGTGGAGCTGGAGCTGG + Intergenic
1161846481 19:6714096-6714118 GGCGTTGGTGGGGCCGGCGCTGG + Intronic
1161922811 19:7279211-7279233 GCCCTTGGGGAGGCTGACGCAGG + Intronic
1162480305 19:10923620-10923642 GCTCTTTGGGGCGCTGGCCCTGG - Exonic
1162565716 19:11445114-11445136 GCCACTGGTGGGGCTGGAGCAGG - Intronic
1162624947 19:11877849-11877871 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1162765499 19:12916994-12917016 GCACTTTGGGAGGCTGGCGCTGG - Intronic
1163284883 19:16340240-16340262 GCTCCTGGTGGGGCAGTTGCTGG - Intergenic
1163293328 19:16394971-16394993 GCACTTTGTGGGGCTGAGGCGGG + Intronic
1163325379 19:16600091-16600113 GCTCCTGGTGGGCCTGGGCCTGG - Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1163708540 19:18832052-18832074 CCTCTCGGTCCGGCTGGCGCCGG + Exonic
1163719026 19:18889534-18889556 GCTCCTGGGGAGGCTGGGGCAGG - Intronic
1164316067 19:24088901-24088923 GCTCTTGGGGAGGCTGATGCAGG - Intronic
1164620439 19:29692676-29692698 GGTCTTGGGGGTGATGGCGCGGG + Intergenic
1164830586 19:31317204-31317226 GCTCTGGCTGGGGCTGGGGCTGG - Intronic
1164947239 19:32306356-32306378 GCTCTGGGAGGGCCAGGCGCGGG - Intergenic
1165123690 19:33579456-33579478 GCTCTTGGGGAGGCTGAGGCGGG + Intergenic
1165564178 19:36709574-36709596 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166925052 19:46261371-46261393 GCTGTGGATGGGGCTGGCCCGGG + Intergenic
1166948701 19:46412594-46412616 GCTTTTTGGGGGGCTGGGGCGGG + Exonic
1167062158 19:47155983-47156005 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1167875351 19:52407527-52407549 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1168241743 19:55092230-55092252 GCTCAAGGTGGAGCTGGAGCGGG - Exonic
1168298971 19:55392636-55392658 GCTCCTGGGGAGGCTGGGGCAGG - Intronic
1168694128 19:58395517-58395539 CATCCTGGTGGGGCTGGCCCAGG + Intergenic
1168710914 19:58499454-58499476 TCTCGGGGCGGGGCTGGCGCGGG - Intronic
925436674 2:3844300-3844322 GCTCTGGGTGTGGCTGTCCCAGG - Intronic
926705890 2:15837236-15837258 GCACTTGGGGGGGCTGAGGCAGG + Intergenic
927186380 2:20485434-20485456 GCCCGTGGTGGGCCTGGCACTGG + Intergenic
927418914 2:22908882-22908904 GCTCTTTGGGAGGCTGGGGCAGG - Intergenic
927557612 2:24047218-24047240 GCTCTTGGTGGGTAGGGGGCGGG - Intronic
927799384 2:26083763-26083785 GCACTTTGTGGGGCCGGCGTGGG - Intronic
927843649 2:26460588-26460610 GCTCTTGGAGGCGCTGGAACAGG - Intronic
927849500 2:26489939-26489961 CCCCTAGGTGGGGCTGGTGCTGG + Intronic
928080085 2:28303708-28303730 GCTTTTGGTGGGGGGGGCGTTGG - Intronic
928499611 2:31876681-31876703 GTTTTTGGTGGGGGTGGGGCAGG - Intronic
928542828 2:32299573-32299595 GCACTTTGGGGGGCTGACGCAGG + Intronic
929428875 2:41870237-41870259 GCTGCTGATGGGGTTGGCGCAGG + Intergenic
930720350 2:54631963-54631985 GCTCTTGGGGAGGCTGGGACAGG + Intronic
930743360 2:54856568-54856590 GATCTTGGAGGGGCTGGTGCTGG + Intronic
932574624 2:72955891-72955913 GCTATAGGTGGGGCTGGTGCTGG - Intronic
933378747 2:81515982-81516004 GCTGATGGTGGGGCTCGGGCGGG + Intergenic
934521863 2:95025037-95025059 GCTGGTGGTGGTGCTGGGGCAGG - Intergenic
935594706 2:104869637-104869659 GCTGGTGGTGGTGCTGGCTCTGG - Intergenic
935671682 2:105561703-105561725 GCCTTTGGTGGGGGTGGTGCTGG - Intergenic
936239325 2:110773509-110773531 GCACTCGCTGGGGCTGGCACTGG - Intronic
936979021 2:118246882-118246904 GCTCTCAGTGGGGCTGGCCCAGG + Intergenic
937089760 2:119198390-119198412 GGCCTTGGTGGGGCTGGCTAGGG - Intergenic
938239607 2:129733207-129733229 GCACTTGGTGAGGCTGGAGGAGG - Intergenic
942746066 2:179234529-179234551 GCACTTTGTGGGGCTGAGGCGGG + Intronic
942839689 2:180345045-180345067 GCTCTTGGAGAGGCTGAGGCAGG + Intergenic
942862839 2:180636418-180636440 GCTCTTGGTGGTGGTGGTGGTGG + Intergenic
943651761 2:190464900-190464922 GCTTTTGGTGGGGGTGGGGGAGG + Intronic
944163746 2:196694615-196694637 GCACTTTGTGGGGCTGAGGCGGG + Intronic
944446973 2:199801702-199801724 GCACTTTGTGGGGCTGAGGCAGG + Intronic
944814919 2:203365873-203365895 GCTCTTTGTGAGGCTGAGGCGGG - Intronic
945316322 2:208374750-208374772 GCACTTTGTGGGGCTGAGGCAGG - Intronic
945394904 2:209306018-209306040 GCTCTTTGTGAGGCTGTGGCTGG + Intergenic
945988272 2:216371834-216371856 GCCCTTGGTGGGGGTAGCGGGGG - Exonic
946122270 2:217526495-217526517 GCTCTGGGTGGGGCAGTGGCAGG + Intronic
946185689 2:217979136-217979158 TTCCTTGGTGGGGCTGGCGTGGG - Intronic
946250100 2:218406448-218406470 GGCCTGGGTGGGGCCGGCGCCGG + Intergenic
946283329 2:218682837-218682859 GCACTTTGTGAGGCTGACGCGGG - Intronic
946858242 2:223974573-223974595 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
947018673 2:225649614-225649636 GCACTTTGTGGGGCTGATGCGGG - Intronic
947171945 2:227320897-227320919 GCCCATGGTGGGGGTGGCTCGGG - Intergenic
948292268 2:236834680-236834702 TCACTTGGTGGAGCTGGGGCAGG - Intergenic
948605480 2:239132030-239132052 GCTCATGGCGGGGCTGGGGGAGG + Intronic
948768072 2:240233580-240233602 GCTGTGGGTGGGGCTGGAGGGGG - Intergenic
948835768 2:240625340-240625362 CCTCTAGCTGGGGCTGGTGCAGG + Intronic
948968355 2:241402975-241402997 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1168958595 20:1852472-1852494 TTTTTTGGTGGGGCTGGGGCAGG - Intergenic
1169867893 20:10219566-10219588 GCTCTGCGGAGGGCTGGCGCGGG + Intronic
1170770104 20:19325332-19325354 GCTACTGGTGGGGCTGAGGCAGG + Intronic
1170871728 20:20212482-20212504 GCTCTTGGTGAGGCAGGGGTGGG - Intronic
1171287262 20:23951494-23951516 GCTCTCCGTGGGGCTGGCCGTGG + Intergenic
1171524281 20:25797189-25797211 GCTGTGGCTGGGGCTGGGGCTGG - Intronic
1171532970 20:25864205-25864227 GCTGTTGCTGGTGCTGGGGCTGG - Intronic
1171552546 20:26058694-26058716 GCTGTGGCTGGGGCTGGGGCTGG + Intergenic
1171806935 20:29688914-29688936 GCTGTGGCTGGGGCTGGGGCTGG + Intergenic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1172482203 20:35277776-35277798 GCTCGGGCTGGGGCTGGGGCTGG + Intergenic
1173809482 20:45947483-45947505 GCTCAGGGTGGGGCTGGGCCTGG - Intronic
1174502473 20:50995882-50995904 GCTCTTGGGGAGGCTGAGGCGGG - Intergenic
1175116938 20:56689388-56689410 GCTCTAGGTGGAGCTGGAGAGGG + Intergenic
1175319986 20:58078687-58078709 GCTCTTGGTGGTGGTGGTGATGG - Intergenic
1175366383 20:58459214-58459236 GCTCCTGGTGGGGATGGCAGTGG - Exonic
1175761540 20:61565058-61565080 GCTCTTGGTGGTGGTGGTGGTGG + Intronic
1175904841 20:62374712-62374734 GCTCTTGGAGGGGCTGCCCAGGG + Intergenic
1175990486 20:62786085-62786107 TCTCCTGGTGGGGCCGTCGCAGG - Intergenic
1175996765 20:62815433-62815455 GCTTGGGGTGGGGCTGGTGCTGG + Intergenic
1176104710 20:63380549-63380571 GCTCCCTGTGAGGCTGGCGCTGG - Intergenic
1176159067 20:63639430-63639452 GCTGTGGGTGGGGCTGGCGGGGG - Intergenic
1176260688 20:64177933-64177955 ACCCTGGGTGGGGCTGGGGCCGG + Intronic
1176331600 21:5553675-5553697 TCTCTTGCTGGCGCTGGCACAGG + Intergenic
1176396157 21:6267276-6267298 TCTCTTGCTGGCGCTGGCACAGG - Intergenic
1176441000 21:6721828-6721850 TCTCTTGCTGGCGCTGGCACAGG + Intergenic
1176465262 21:7048897-7048919 TCTCTTGCTGGCGCTGGCACAGG + Intergenic
1176488823 21:7430675-7430697 TCTCTTGCTGGCGCTGGCACAGG + Intergenic
1178514793 21:33237283-33237305 GCCCTTTGTGGGGCTGAGGCCGG + Intronic
1178821819 21:35982418-35982440 GCTCTTGGTGGGGCAGTCAGGGG - Intronic
1179110188 21:38439443-38439465 GCCCTTGGTGTGGATGGCACAGG + Intronic
1180195575 21:46191650-46191672 GCTCTGGGTGGGGGAGGAGCTGG - Intronic
1180414210 22:12693754-12693776 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
1180766868 22:18350369-18350391 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
1180766873 22:18350381-18350403 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1180779440 22:18511997-18512019 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1180779445 22:18512009-18512031 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1180812156 22:18769318-18769340 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1180812161 22:18769330-18769352 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1181031475 22:20150418-20150440 GCGGTGGGTGGGGCTGGGGCTGG + Intronic
1181035058 22:20165835-20165857 GCTCTCGGTGAGGCTGGCTGTGG - Intergenic
1181198315 22:21203565-21203587 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1181198320 22:21203577-21203599 GGTCCTGCTGGGGCTGGGGCTGG - Intergenic
1181401424 22:22652222-22652244 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
1181401426 22:22652228-22652250 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1181493496 22:23275182-23275204 TCTCCTGGTGGGCCTGGCCCAGG + Intronic
1181508760 22:23379524-23379546 GCTCTGGGTGAGGCTGGCTAGGG + Intergenic
1182098759 22:27643216-27643238 GCACTTTGTGGGGCTGAGGCTGG + Intergenic
1182226774 22:28804889-28804911 GCTCTTTGGGAGGCTGGGGCGGG + Intergenic
1182314279 22:29433572-29433594 GCTGTTGGTGGGCCGAGCGCAGG - Intergenic
1182356953 22:29726472-29726494 GCTGTTGCTTGGGCTGGCCCAGG - Intronic
1182370724 22:29808572-29808594 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1182803411 22:33050702-33050724 GATAATGGTGGGGCTGGAGCAGG - Intronic
1182942508 22:34290961-34290983 GCACTTGGGGAGGCTGGGGCGGG + Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183544711 22:38449238-38449260 GGTCCTGGAGGGGCTGGCACTGG + Intronic
1183601108 22:38841171-38841193 CCTCTGGGAGGGGCTGGGGCTGG - Intronic
1184280658 22:43435608-43435630 GCACTTTGTGGGGCTGAGGCTGG + Intronic
1184452754 22:44592623-44592645 GGTCTTGGTGGGGCAGCCACGGG - Intergenic
1184617053 22:45645501-45645523 GCTTGCGGTGGGGCTGGGGCCGG + Intergenic
1184839776 22:47045969-47045991 GGTCTTAGTGGGGATGGCCCTGG + Intronic
1184948074 22:47818407-47818429 GCTCTTGGTGGGTGAGGGGCAGG - Intergenic
1185391886 22:50566454-50566476 GCTCCTGGTGGTGGTGGAGCTGG - Intergenic
1203228487 22_KI270731v1_random:91260-91282 GGTCCTGCTGGGGCTGGGGCTGG + Intergenic
1203228492 22_KI270731v1_random:91272-91294 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
950242413 3:11383558-11383580 GCTATTTGTGGGGCTGAGGCAGG - Intronic
950388304 3:12677034-12677056 GCCCTTGGTGGGGCAGGGGGAGG - Intergenic
950462224 3:13131731-13131753 GCACTTTGTGGGGCTGATGCAGG - Intergenic
950499397 3:13354204-13354226 GCTCTTGGGGGTGCTGGTGAGGG + Intronic
950577106 3:13838560-13838582 GCTGCTGTTGGGGCTGGCTCAGG + Intronic
950639514 3:14339862-14339884 GCACTTTGTGGGGCTGAGGCGGG - Intergenic
952154288 3:30626396-30626418 ACTCTTGGTGGGGCTGGTAGTGG + Intronic
952901220 3:38112738-38112760 GCCCTTGGTGGGGCTCACCCAGG + Intronic
953407239 3:42665490-42665512 GCTATTAGTGGGGCAGGGGCAGG + Exonic
954107162 3:48415591-48415613 GCTCTTGGTGGGGCCAGCAGAGG + Exonic
954247032 3:49340113-49340135 GCTCGAGGTGGGGCAGGGGCGGG - Intronic
954276024 3:49542213-49542235 GCTCTTGGGGAGCCTGGGGCTGG - Intergenic
954303831 3:49715188-49715210 GCTCTTGGAGGAGCTGGCCTTGG + Intronic
954306309 3:49727305-49727327 GGTGTTGCTGGGGCTGGTGCTGG + Exonic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954670005 3:52285697-52285719 GCTACTGGTGGGGCTGAGGCAGG - Intronic
955369062 3:58335120-58335142 GCACTTTGTGGGGCTGAGGCAGG - Intronic
955387644 3:58492167-58492189 GCAGTGAGTGGGGCTGGCGCGGG + Intronic
955780780 3:62482209-62482231 ATTCTTGGTGTGGCTGGGGCTGG + Intronic
956138788 3:66125370-66125392 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
956295663 3:67710604-67710626 CCTCTGGGTGGTGCTGGTGCTGG + Intergenic
956801273 3:72761416-72761438 GCTCTTTGGGAGGCTGGGGCAGG - Intronic
957857453 3:85896042-85896064 GCCCTTTGTGGGGCTGAGGCAGG + Intronic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960009452 3:112817609-112817631 GCAGTTGGTGGGGCTGAGGCAGG - Intronic
960707093 3:120492014-120492036 GCTCTTGGTGGGACTCGAGATGG - Intergenic
961107566 3:124255188-124255210 GCACTTGGTGAGGCTGAGGCGGG - Intronic
961437802 3:126931436-126931458 GGTCTTGGTGAGGCTGCTGCAGG + Intronic
962581108 3:136798829-136798851 GCTATTAGGGGGGCTGGGGCAGG - Intergenic
962717813 3:138142494-138142516 GCTCTTTGGGAGGCTGGGGCAGG + Intergenic
962884542 3:139611919-139611941 GCACTTTGTGGGGCTGAGGCGGG + Intronic
964576322 3:158173240-158173262 TCTATTGGTGGGGCTGGAGCAGG + Intronic
964771195 3:160225707-160225729 GCTACTGCTGGCGCTGGCGCTGG + Exonic
965820220 3:172677632-172677654 GCTGTTGGTGGGGGAGGGGCGGG + Intronic
966656492 3:182364393-182364415 GCTGTTGGCAGGGCTGGCACTGG + Intergenic
966945136 3:184772433-184772455 GCACTTTGTGGGGCTGAGGCGGG + Intergenic
967189011 3:186969297-186969319 GCACTTTGTGGGGCTGAGGCGGG - Intronic
967543011 3:190691148-190691170 GCTCTTGGGGAGGCTGATGCAGG + Intergenic
967690011 3:192463170-192463192 GCACTTTGTGGGGCTGAGGCAGG + Intronic
967847848 3:194058263-194058285 GCTGATGCTGGGGCTGGGGCTGG - Intergenic
967902179 3:194465715-194465737 GCTCTTTGGGAGGCTGGTGCGGG + Intronic
968010451 3:195270897-195270919 CCTCTTGGTGGCGCTGGAGAAGG + Exonic
968014496 3:195317142-195317164 GCACTTGGGGAGGCTGGGGCAGG - Intronic
968215334 3:196884782-196884804 GCTCCTGGTGAGGCTGAGGCAGG - Intronic
968320020 3:197758160-197758182 GCACTTTGTGGGGCTGAGGCAGG - Intronic
968343626 3:197981159-197981181 GCTCTTTGTGAGGCTGAGGCGGG + Intronic
968390702 4:190792-190814 GCACTTGGGGAGGCTGGGGCGGG + Intergenic
968460667 4:723334-723356 GCACCTGGAGGGGCTGGCCCTGG + Intronic
968477372 4:818343-818365 GCCCGTGGCGGGGCTGGGGCTGG - Intronic
968502011 4:955186-955208 GCACTTTGTGGGGCTGAGGCAGG - Intronic
968509606 4:989648-989670 GCTGCTGGTGCTGCTGGCGCTGG - Exonic
968779857 4:2572215-2572237 GCTATTGGGGAGGCTGGGGCAGG + Intronic
968949510 4:3683336-3683358 GCTTTTGGTGGGGGTGTGGCTGG + Intergenic
968977866 4:3831234-3831256 GCTCTTGTTGGGGGTGGCAGTGG - Intergenic
969331314 4:6474731-6474753 GCTTGTGGTGGGGGTGGGGCAGG - Intronic
970927851 4:21473823-21473845 GCTCTTGGGGAGGCTGAGGCAGG - Intronic
973888400 4:55346139-55346161 GGTCCTGGTCGCGCTGGCGCTGG - Exonic
974304291 4:60111898-60111920 GATCTTTGTGGGGTTGGTGCGGG - Intergenic
974542615 4:63257680-63257702 GCACTTTGTGGGGCTGAGGCGGG - Intergenic
975134815 4:70864397-70864419 GCACTTGGGGAGGCTGGGGCAGG + Intergenic
976428622 4:84936272-84936294 GCTCTTTGTGAGGCTGAGGCAGG + Intronic
976547950 4:86359568-86359590 GCTCCTGGTGGGGCGGGAGAGGG - Intronic
976915453 4:90368519-90368541 GCTCCTGGGGTGGCTGACGCAGG + Intronic
978542777 4:109836806-109836828 GCACTTTGTGAGGCTGGGGCAGG + Intronic
978892938 4:113851830-113851852 TCTCTTGGTGGGTCTGACTCAGG + Intergenic
984378927 4:178965715-178965737 GCACTTTGAGGGGCTGGGGCAGG - Intergenic
984962263 4:185109356-185109378 GCACTTGGTGAGGCTGAGGCAGG + Intergenic
985446012 4:190021724-190021746 GTCCGTGGTGGGGCTGGGGCCGG - Intergenic
985451372 4:190065561-190065583 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985452362 4:190068854-190068876 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985453347 4:190072151-190072173 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985454337 4:190075444-190075466 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985455325 4:190078737-190078759 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985456313 4:190082037-190082059 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985457297 4:190085331-190085353 GTCCGTGGTGGGGCTGGGGCCGG + Intergenic
985458284 4:190088624-190088646 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985459273 4:190091924-190091946 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985463525 4:190174693-190174715 GTCCGTGGTGGGGCTGGGGCCGG + Exonic
985549087 5:524265-524287 GCTGCTGCTGGCGCTGGCGCTGG - Exonic
985579551 5:689653-689675 GCTCTGGGAGGGGGTGGCTCTGG + Intronic
985594397 5:781712-781734 GCTCTGGGAGGGGGTGGCTCTGG + Intergenic
985625116 5:981824-981846 GCTCGGGGTGGGGCTGAAGCAGG - Intergenic
985625138 5:981898-981920 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625161 5:981972-981994 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625180 5:982046-982068 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625203 5:982120-982142 GCTCGAGGTGGGGCTGAGGCAGG - Intergenic
985625220 5:982194-982216 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
985814629 5:2117433-2117455 TCTCTTGGTGGCGAGGGCGCTGG + Intergenic
987282885 5:16428148-16428170 GATGTTGCTGGGGCTGGGGCTGG - Intergenic
988500904 5:31782958-31782980 GCACTTTGTGGGGCTGAGGCAGG - Intronic
990373702 5:55148465-55148487 GCTCTTTGTGAGGCTGAGGCAGG + Intronic
990510258 5:56482883-56482905 GCTCTTTGGGAGGCTGGGGCAGG - Intergenic
991559332 5:67932947-67932969 GATCTTGGTGGTGCTGGCTCTGG + Intergenic
993384453 5:87247481-87247503 GCACTTTGTGGGGCTGAGGCGGG + Intergenic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
995819159 5:116207763-116207785 GCACTTTGTGGGGCTGAGGCAGG - Intronic
996493857 5:124130515-124130537 GCCCTTGGTGGGGCAGGGCCTGG - Intergenic
997286458 5:132682235-132682257 GCTTTTGGGGTGGGTGGCGCGGG - Intronic
997560035 5:134838422-134838444 GCACTTTGTGGGGCTGAGGCAGG + Intronic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
1000366680 5:160497866-160497888 GCATTTGGTGGGGCTGAGGCTGG + Intergenic
1001159423 5:169300596-169300618 ACACTTGGTGGGGCAGGCGACGG + Exonic
1001617747 5:173056583-173056605 GCTCTGGGCCGGGCCGGCGCGGG + Intronic
1002000479 5:176193980-176194002 GCCCTTGGTGAGGCTGCCGTGGG - Intergenic
1002642755 5:180638293-180638315 GCCTTTGGTGGGGCTGGAGGGGG - Intronic
1004206887 6:13599405-13599427 GTTTTTGGTGGGGCTGGGGGAGG - Intronic
1005227625 6:23660731-23660753 GCCCTTGGTGGGGGTGGGCCAGG - Intergenic
1006109003 6:31733734-31733756 GATGGTGGTGGGGCTGGGGCAGG - Intronic
1007679810 6:43626272-43626294 GCTGCTGGTGGGGCTGGCTGAGG - Exonic
1010706671 6:79121533-79121555 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1013256026 6:108386347-108386369 GCTATTTGGGGGGCTGGGGCAGG + Intronic
1017950271 6:159130240-159130262 GCTGATGGTGGGGCAGGGGCAGG - Intergenic
1018231458 6:161679864-161679886 GCTCCTGGGGGGGCTGAGGCAGG - Intronic
1018261134 6:161972025-161972047 GCACTTGGTGGGGCTAAGGCGGG + Intronic
1019612281 7:1942570-1942592 CCTCTTGGTGGGGTGGGTGCAGG - Intronic
1019632481 7:2057119-2057141 TCTCTAGGTGGGGCTGGGGCAGG - Intronic
1019634125 7:2066528-2066550 GGTCGGGGTGAGGCTGGCGCGGG + Intronic
1020277271 7:6632313-6632335 GCAGTTGGTGGGGTTGGGGCTGG - Intergenic
1021160326 7:17264681-17264703 GGTATTGGTGGGGTTGGGGCAGG - Intergenic
1022213776 7:28237631-28237653 GCTCTTGCTGGGGAAGGCGCTGG + Intergenic
1022495423 7:30850216-30850238 GCCCTGGGTGGGGCTGGTGAAGG - Intronic
1023039041 7:36156160-36156182 GTTGTTGGTGAGGCTGGCGGCGG + Intronic
1023817432 7:43961643-43961665 GCTCTTCCTGGGGCAGGGGCTGG - Intergenic
1025057636 7:55777932-55777954 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1025839993 7:65137223-65137245 GCACGTGGTGGGGTTGGCGGGGG + Intergenic
1025883073 7:65558741-65558763 GCACGTGGTGGGGTTGGCGGGGG - Intergenic
1025890373 7:65643864-65643886 GCACGTGGTGGGGTTGGCGGGGG + Intergenic
1026674855 7:72419902-72419924 GCTCTTGGTGGAGAGGGAGCTGG - Intronic
1026718834 7:72813498-72813520 GCTCCTGGTGATGCTGACGCAGG - Intronic
1026900346 7:74033594-74033616 GCCCTGGGAGGGGGTGGCGCCGG + Intronic
1026939027 7:74276162-74276184 GCTATTTGTGAGGCTGACGCAGG + Intergenic
1027466111 7:78516597-78516619 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1027499750 7:78934348-78934370 GCACTTTGTGGGGCTGAGGCAGG - Intronic
1027801176 7:82751334-82751356 GCTCCTTGGGAGGCTGGCGCAGG + Intergenic
1028536942 7:91900317-91900339 GCACTTTGTGAGGCTGACGCGGG - Intergenic
1029742057 7:102496517-102496539 GCTCTTCCTGGGGCAGGGGCTGG - Exonic
1029760046 7:102595682-102595704 GCTCTTCCTGGGGCAGGGGCTGG - Exonic
1030001669 7:105070699-105070721 GCTCTTTGGGGGGCTGAGGCAGG + Intronic
1030044762 7:105485099-105485121 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1031135443 7:117879203-117879225 GCACTTTGGGGGGCTGGGGCGGG - Intergenic
1032016622 7:128384130-128384152 GAGGTTGGTGGGGCTGGCACGGG + Intergenic
1032628966 7:133625958-133625980 GCACTTTGTGGGGCTGAGGCAGG + Intronic
1033080701 7:138294434-138294456 GCACTTTGGGAGGCTGGCGCAGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037374991 8:18217828-18217850 GCTGTTGCAGGGGCTGGTGCAGG + Intronic
1038795207 8:30703633-30703655 GCTCTTTGAGGGGCTGAGGCAGG + Intronic
1039059254 8:33560484-33560506 GCCCTTTGTGGGGCTGAGGCAGG - Intronic
1039186037 8:34917199-34917221 GCTCTTCGTGAGGCTGAGGCAGG + Intergenic
1039428018 8:37502934-37502956 CCTGTTGGTGGGGCTGGCGTTGG - Intergenic
1039497244 8:37989595-37989617 GCACTTTGTGGGGCTGAGGCAGG + Intergenic
1040038691 8:42896238-42896260 GCTCTAGGTGGGTTTGGCGGCGG - Exonic
1041545168 8:59034440-59034462 GCTCTTCGTGGGGGTGGAGGTGG - Intronic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1043446871 8:80327573-80327595 TGTCTTGGTGGGGGTGGAGCGGG + Intergenic
1043851763 8:85224391-85224413 GCACTTTGGGGGGCTGGGGCAGG - Intronic
1043939019 8:86175317-86175339 GCGCTTTGTGGGGCTGAGGCAGG - Intergenic
1044674777 8:94718510-94718532 GCACTTTGTGGGGCTGAGGCCGG + Intergenic
1045290186 8:100826256-100826278 CCTCCTGCTGGGGCTGGAGCTGG + Intergenic
1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG + Intergenic
1045497375 8:102719776-102719798 GATCTTGGCGGGGCTGTCGGGGG + Intergenic
1046913442 8:119654589-119654611 GCACTTTGTGGGGCTGAGGCGGG - Intronic
1047254926 8:123207484-123207506 GGCCTTGGTGGGGCTGGAACCGG - Exonic
1047917301 8:129595782-129595804 GCTCTTTGGGGGGCTGAAGCAGG - Intergenic
1048195574 8:132329297-132329319 GCACATGGTGGGGCTGGTGGAGG - Intronic
1048444965 8:134486389-134486411 CCTCTTGGTGGTGGTGGCGACGG - Intronic
1048710601 8:137206217-137206239 GCTATTGGGGAGGCTGGAGCAGG - Intergenic
1049421745 8:142519701-142519723 GGTGTTGGTGGTGCTGGTGCTGG + Intronic
1049696894 8:143988575-143988597 GCTATTGGGGGGGCTGAGGCAGG - Intronic
1049807493 8:144547550-144547572 GCCCTCAGTGGGGGTGGCGCTGG + Exonic
1051160619 9:14203632-14203654 GCCCTTGGTGAGGCGGGCCCAGG - Intronic
1051243940 9:15090143-15090165 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1052916762 9:33929067-33929089 GCTCCTGGTGGGGCTCTCTCCGG - Intronic
1052939530 9:34121631-34121653 GCTCTTGAAGGGGCTGGGGGTGG - Intronic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054159033 9:61660779-61660801 GCTCTTGGCGGGGCTGGGGTTGG + Intronic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054449590 9:65396410-65396432 GCTCTTGGTGGGGCTGCGGTTGG - Intergenic
1054478807 9:65591784-65591806 GCTCTTGGCGGGGCTGGGGTTGG + Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1056201147 9:84278005-84278027 GTTCTTGGTGGGGAAGGGGCTGG + Exonic
1057195350 9:93113339-93113361 GCTCCAGCTGGGGCTGGCCCTGG + Intergenic
1057305303 9:93908895-93908917 GCCCATGGTGGGGCCAGCGCTGG + Intergenic
1057815446 9:98290638-98290660 GCTGGCGGTGGGGCTGACGCAGG + Exonic
1057838078 9:98463133-98463155 GCACTTGGGGAGGCTGACGCAGG - Intronic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1059299093 9:113298426-113298448 GCTCTTGGTAGGGGTGGCCCAGG - Exonic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060267484 9:122120969-122120991 GCCATGGGTGGGGCTGGTGCTGG - Intergenic
1061579289 9:131527019-131527041 GCTCTGGGTGGGGCTGGGGCCGG + Intronic
1061810799 9:133161988-133162010 GGTCTTGTTGGGGCTGGGGTTGG + Intronic
1061908989 9:133712958-133712980 GCTCTGGGGGAGGCGGGCGCAGG - Intronic
1061917715 9:133763816-133763838 GCTCTGGGTGGGGCTAGCCCAGG + Exonic
1062029347 9:134355116-134355138 GTTCAAGGTGGGGCTGGGGCTGG + Intronic
1062063679 9:134514506-134514528 GCTCAGGGTGGGGCTGGGGTGGG - Intergenic
1062221448 9:135418247-135418269 GCTCATGGTCTGGCTGGGGCGGG - Intergenic
1062518328 9:136947001-136947023 GGCCTTGGTGGTACTGGCGCCGG - Intronic
1062572116 9:137190535-137190557 GCTCAGGGTGGGGCTGGCCTGGG - Intergenic
1062624464 9:137436520-137436542 GCTCCTCGTGGGGCTGGTACAGG - Exonic
1062650894 9:137576776-137576798 GCTCTTAGGGAGGCTGACGCAGG + Intronic
1185807241 X:3069556-3069578 GCTCTTTGGGGGGCTGAGGCAGG - Intronic
1186883065 X:13885683-13885705 GCCCTTGGTGGGGCGGGGACGGG - Intronic
1188264310 X:28051901-28051923 GCTCTTTGGGAGGCTGGGGCAGG - Intergenic
1188881519 X:35497597-35497619 GCACTTTGCGGGGCTGGGGCGGG - Intergenic
1189377673 X:40478388-40478410 GCACTTTGTGGGGCTGAGGCAGG - Intergenic
1189726898 X:43976171-43976193 GATCTTGGTGGGGGTGGGGATGG - Intergenic
1190005369 X:46731488-46731510 GCTATTTGTGAGGCTGGGGCAGG + Intronic
1190299718 X:49050082-49050104 GCTATTCGTGGGGCTGAGGCAGG - Intergenic
1190735055 X:53250594-53250616 GGCCCTGGTGGGGCTGGGGCTGG + Exonic
1191922739 X:66274476-66274498 GCTCTTGGTTTGGCTGTTGCTGG - Intergenic
1192907722 X:75569336-75569358 GATATTGGTGAGGCTGGCGGTGG + Intergenic
1193467500 X:81867087-81867109 GCTCTTTGTGAGGCTGCAGCTGG + Intergenic
1195119102 X:101731938-101731960 GCACTTTGTGGGGCTGGGGTGGG + Intergenic
1195779873 X:108450338-108450360 GCTCTTTGGGGGGCTGAAGCAGG - Intronic
1195784882 X:108508237-108508259 GCTCTTGGTGTGGCTGTTGTTGG - Intronic
1196302689 X:114064808-114064830 GCTCTTTGGGAGGCCGGCGCGGG + Intergenic
1197224085 X:123939376-123939398 GCTCTTGTTGGGTCTTGTGCTGG + Intergenic
1197794942 X:130288546-130288568 GCTCTTTGGGGGGCTGAGGCAGG - Intergenic
1200141521 X:153905129-153905151 GAGCATGGTGGGGCTGGGGCAGG - Exonic
1200162467 X:154016548-154016570 GCTCTGGCTGGGGCTGGACCCGG + Exonic
1200425267 Y:3013513-3013535 GCTCTTTGTGTGGCTGTGGCAGG + Intergenic
1200569585 Y:4811787-4811809 GCTCTTTGTGAGGCTGAGGCAGG - Intergenic
1200733274 Y:6766163-6766185 GCACTTTGGGAGGCTGGCGCAGG - Intergenic
1201073188 Y:10168766-10168788 GCTCCTGGTGGGGCTGCAGCCGG - Intergenic
1201177088 Y:11315840-11315862 GTCCGTGGTGGGGCTGGAGCCGG + Intergenic
1201383387 Y:13411735-13411757 GCTCTTTGGGAGGCTGGTGCAGG - Intronic