ID: 1160157197

View in Genome Browser
Species Human (GRCh38)
Location 18:76442805-76442827
Sequence GGCTCCGGATGTGAATCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160157188_1160157197 13 Left 1160157188 18:76442769-76442791 CCGGCTCGTGTCCCTGAATCAGA 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157184_1160157197 25 Left 1160157184 18:76442757-76442779 CCTCGCCCGCCTCCGGCTCGTGT 0: 1
1: 0
2: 0
3: 12
4: 293
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157190_1160157197 1 Left 1160157190 18:76442781-76442803 CCTGAATCAGAGTCCCCGTGCGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157189_1160157197 2 Left 1160157189 18:76442780-76442802 CCCTGAATCAGAGTCCCCGTGCG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157185_1160157197 20 Left 1160157185 18:76442762-76442784 CCCGCCTCCGGCTCGTGTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 231
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157186_1160157197 19 Left 1160157186 18:76442763-76442785 CCGCCTCCGGCTCGTGTCCCTGA 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1160157187_1160157197 16 Left 1160157187 18:76442766-76442788 CCTCCGGCTCGTGTCCCTGAATC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160157197 Original CRISPR GGCTCCGGATGTGAATCTTC AGG Exonic
902696335 1:18143243-18143265 GGCTCAGGATGCGGAGCTTCAGG + Intronic
904503043 1:30928556-30928578 GGCACAGGTTCTGAATCTTCAGG + Intergenic
913097543 1:115533970-115533992 GGCTCTGGAAGAGGATCTTCAGG - Intergenic
922196221 1:223363078-223363100 GGCTCCACATGGGAATTTTCAGG + Intronic
1064399168 10:15006497-15006519 GTCTCGGAATGTGAAACTTCAGG + Intergenic
1070480099 10:76873927-76873949 GTTTCCCCATGTGAATCTTCAGG - Intronic
1070891546 10:79945217-79945239 GGCCCCGGATTTGAATCTCAGGG - Intronic
1077416615 11:2427016-2427038 GGCTCTGGATCTGAGACTTCAGG - Intergenic
1077604389 11:3598293-3598315 GTCTCAGAATGTGAAACTTCAGG + Intergenic
1078639064 11:13078586-13078608 AGCTCCGAATGTGTATCTGCAGG + Intergenic
1082834309 11:57640349-57640371 GGCTTTGGGTGTTAATCTTCCGG + Intergenic
1084226840 11:67721109-67721131 GTCTCGGGATGTGAAACTTCAGG + Intergenic
1084808352 11:71595745-71595767 GTCTCGGAATGTGAAACTTCAGG - Intronic
1084812488 11:71622359-71622381 GTCTCGGAATGTGAAACTTCAGG - Intergenic
1084845458 11:71895754-71895776 GTCTCGGAATGTGAAACTTCAGG - Intronic
1084945937 11:72638476-72638498 GGCTCCGCATGTGCACCCTCTGG - Intronic
1092595268 12:9996851-9996873 TGTTCCGGTTGTCAATCTTCAGG + Exonic
1092881645 12:12891698-12891720 GCCTCCGGATTTAAATCGTCTGG + Intronic
1101318850 12:103654750-103654772 TGCTCTGGATGTGACTCTCCAGG - Intronic
1101939911 12:109092237-109092259 GGCTACTGATGAGTATCTTCTGG - Intronic
1103399027 12:120629922-120629944 GCCTCCGGCTCTGAATCTTATGG + Intergenic
1107546475 13:41438153-41438175 GTCTCGGAATGTGAAACTTCAGG + Intergenic
1109839570 13:67904540-67904562 GTCTCGGAATGTGAAACTTCAGG - Intergenic
1113853172 13:113429370-113429392 GTCTCCGGATGTGACTGCTCTGG + Intronic
1114208473 14:20595843-20595865 GGATCTGGGTGTGAATCTGCTGG + Intronic
1115379869 14:32723444-32723466 GTCTCTGGATATGAATCTGCAGG - Intronic
1117039772 14:51759309-51759331 GTCTCGGAATGTGAAACTTCAGG - Intergenic
1129300462 15:74622586-74622608 GGCTCCGGATGTGATCTTCCTGG + Intronic
1130617885 15:85429728-85429750 GGCTCTGGATGAGAATATCCTGG + Intronic
1132638401 16:965361-965383 GGCTCTGGATGAGGCTCTTCTGG - Intronic
1139962255 16:70724730-70724752 AGCTCCTTGTGTGAATCTTCTGG - Intronic
1140293700 16:73688055-73688077 GGCTCAAGATGTGAATTTTGGGG - Intergenic
1142109231 16:88322449-88322471 GGCTGCGGCTGTGGAGCTTCAGG - Intergenic
1142155738 16:88532207-88532229 GGCTGCGCATGTGGATCTCCAGG - Exonic
1142822374 17:2480455-2480477 GGCTCTGGCTGTGTCTCTTCAGG - Intronic
1143016550 17:3893661-3893683 GCCTCCGCGTGTGAATCCTCTGG + Intronic
1146411169 17:32586863-32586885 GTCTCAGGATGTGAGTCATCTGG + Intronic
1148491117 17:48024453-48024475 GGCTCCGGATGGGGAACTGCTGG - Intergenic
1160157197 18:76442805-76442827 GGCTCCGGATGTGAATCTTCAGG + Exonic
1162196159 19:8986395-8986417 GGCTGCTGTTGTGAATCATCTGG + Intergenic
1164722689 19:30444078-30444100 GGGTCCGCAGGTGAATCTTGAGG - Exonic
1165061543 19:33207399-33207421 GGCTCCCGAGGTGCATCTGCAGG - Exonic
1165196453 19:34107834-34107856 GGTTCCAAGTGTGAATCTTCTGG - Intergenic
925296559 2:2781056-2781078 GGCGCAGGGTGTGAATCTTGGGG - Intergenic
932350936 2:71031262-71031284 GTCTCGGAATGTGAAACTTCAGG - Intergenic
932681378 2:73828946-73828968 GGCGCCGGATGTGACGTTTCCGG + Intronic
937402864 2:121600226-121600248 GGCTCCAGATGTGAACATGCAGG + Intronic
940870463 2:158855908-158855930 GTCTCGGAATGTGAAACTTCAGG - Intronic
945435054 2:209809289-209809311 GGCTTCGGATGTGTTTCTTGAGG - Intronic
947412793 2:229859173-229859195 GGCTCCGGGTCTGAATCAACTGG - Exonic
1168925320 20:1574425-1574447 GGCTGTGTATGAGAATCTTCTGG + Intronic
1168929198 20:1607453-1607475 GGCTGTGTATGAGAATCTTCTGG + Intronic
1172367809 20:34363396-34363418 GAGTCCGGATGAGAATGTTCGGG + Intronic
1173406885 20:42774081-42774103 GGCTCCTAGTGTGAATATTCTGG + Intronic
1173615525 20:44400785-44400807 GGCCCCAGATGCCAATCTTCTGG - Intronic
1174353602 20:49984245-49984267 GGCTTCGGATGTGCATCTTGAGG - Exonic
1181778498 22:25176776-25176798 AGCTCCGAGTGTGAGTCTTCAGG + Intronic
1183466284 22:37981944-37981966 GGGGCGGGATGTGAATCTTTTGG + Intronic
1185202960 22:49519479-49519501 GCTTCCAGCTGTGAATCTTCTGG - Intronic
949885536 3:8690491-8690513 GTCTCAGAATGTGAAACTTCAGG - Intronic
952943682 3:38461501-38461523 GGCTCCTTCTGTGAACCTTCTGG + Intronic
961273206 3:125705685-125705707 GTCTCGGAATGTGAAACTTCAGG - Intergenic
961275948 3:125726841-125726863 GTCTCGGAATGTGAAACTTCAGG - Intergenic
961875531 3:130020199-130020221 GTCTCAGAATGTGAAACTTCAGG + Intergenic
968987891 4:3887957-3887979 GTCTCGGAATGTGAAACTTCAGG + Intergenic
969023528 4:4155140-4155162 GTCTCGGAATGTGAAACTTCAGG + Intergenic
969735162 4:8983750-8983772 GTCTCGGAATGTGAAACTTCAGG - Intergenic
969789887 4:9486053-9486075 GTCTCGGAATGTGAAACTTCAGG - Intergenic
969794369 4:9515219-9515241 GTCTCAGAATGTGAAACTTCAGG - Intergenic
974944307 4:68508242-68508264 GGCTTTGGCTGTGAATATTCTGG + Intergenic
992677759 5:79122814-79122836 GGCTCCAGATTTGAATATTGTGG - Intronic
1005708427 6:28480360-28480382 GCTTCCGGCTGCGAATCTTCAGG + Intergenic
1007391543 6:41552247-41552269 GGATGCGGATGTGCATCTGCAGG - Intronic
1008130734 6:47717968-47717990 GGCTCCTAATGTGAATCTGTAGG - Intronic
1009397406 6:63215212-63215234 GCTTTTGGATGTGAATCTTCTGG + Intergenic
1013412547 6:109894320-109894342 GCCTTCGGATGTTAATCTCCTGG - Intergenic
1018956723 6:168415437-168415459 GGCTCAGGAGGGGAATGTTCTGG - Intergenic
1022112540 7:27240299-27240321 GGCTCCAGATCTGAAGCTTCAGG - Intergenic
1024049630 7:45610462-45610484 GCCTCTGGATGTAAATCTTGTGG - Exonic
1029909176 7:104125754-104125776 TGCTGTGGATGTCAATCTTCAGG + Intergenic
1036261608 8:7245251-7245273 GTCTCAGAATGTGAAACTTCAGG + Intergenic
1036304986 8:7594305-7594327 GTCTCAGAATGTGAAACTTCAGG - Intergenic
1036313648 8:7703795-7703817 GTCTCAGAATGTGAAACTTCAGG + Intergenic
1036355836 8:8042301-8042323 GTCTCAGAATGTGAAACTTCAGG - Intergenic
1036819325 8:11927195-11927217 GTCTCGGAATGTGAAACTTCAGG + Intergenic
1036902677 8:12682798-12682820 GTCTCGGAATGTGAAACTTCAGG + Intergenic
1039050168 8:33485326-33485348 CGCTCTGGATGTGAGGCTTCCGG + Intronic
1039989956 8:42479039-42479061 GGCTCGGGACATGACTCTTCTGG + Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1052071953 9:24092652-24092674 GGCACCGAACGTGAATGTTCTGG - Intergenic
1054921232 9:70544444-70544466 GGCCCCGCATGTCAATCTCCTGG - Intronic
1056395635 9:86178954-86178976 GGCCCCGGATGTCAATTTTTAGG - Intergenic
1056866798 9:90234464-90234486 GTCTCAGAATGTGAAACTTCAGG - Intergenic
1056916364 9:90749871-90749893 GTCTCGGAATGTGAAACTTCAGG + Intergenic
1192560457 X:72124661-72124683 GGCTCTGGATGTCAAACTGCTGG + Intergenic
1197609300 X:128621200-128621222 GGCTTCAGATGGGAAACTTCAGG - Intergenic