ID: 1160157273

View in Genome Browser
Species Human (GRCh38)
Location 18:76443163-76443185
Sequence CAGGAGGTGCACCTTCTACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160157264_1160157273 25 Left 1160157264 18:76443115-76443137 CCGTCCTATCTCTCCATGGTCAG 0: 1
1: 0
2: 0
3: 23
4: 208
Right 1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG 0: 1
1: 0
2: 1
3: 11
4: 121
1160157266_1160157273 12 Left 1160157266 18:76443128-76443150 CCATGGTCAGAAGAGCCAAAAGA 0: 1
1: 0
2: 4
3: 30
4: 288
Right 1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG 0: 1
1: 0
2: 1
3: 11
4: 121
1160157265_1160157273 21 Left 1160157265 18:76443119-76443141 CCTATCTCTCCATGGTCAGAAGA 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG 0: 1
1: 0
2: 1
3: 11
4: 121
1160157267_1160157273 -3 Left 1160157267 18:76443143-76443165 CCAAAAGACGTGCCTGCTCCCAG 0: 1
1: 0
2: 1
3: 17
4: 183
Right 1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG 0: 1
1: 0
2: 1
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160157273 Original CRISPR CAGGAGGTGCACCTTCTACA TGG Exonic
901830201 1:11887518-11887540 CAGGGGGTTCACCTTCTCCAAGG - Intergenic
905353166 1:37361399-37361421 GAGGAGTTCCAACTTCTACAAGG - Intergenic
906719567 1:47995853-47995875 CTGGAGGTGCACCTTGCCCAAGG + Intronic
907185519 1:52606179-52606201 CAGTAGGTTCACATTCTAGAAGG + Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
907243146 1:53091629-53091651 CAGGAGGTGCATCTGCTGCCAGG + Intronic
907551717 1:55310416-55310438 CAGGAGGGGCGCCTGCAACATGG + Intergenic
908537829 1:65094749-65094771 AAGGAGGTGAAACATCTACAAGG - Intergenic
912344120 1:108948277-108948299 CAGGAACTGCAGCTTCTCCAGGG + Intronic
923365771 1:233259085-233259107 CAGGTGGGGCAACTTCTTCAAGG + Exonic
924112627 1:240714817-240714839 CAGCAGGTGCAATTTCTACCCGG - Intergenic
1063038708 10:2315341-2315363 CAGGTGGACCACCTGCTACATGG + Intergenic
1063064103 10:2591283-2591305 CAGGTGCTCCACCTTCTGCAGGG - Intergenic
1063686208 10:8239434-8239456 TAGGAGGTGCAGCTTCAGCAAGG + Intergenic
1065565296 10:27001945-27001967 CAGGAGTGTCACCCTCTACAGGG + Intronic
1067170030 10:43898722-43898744 CAGGAAGTGCACATTCCCCAGGG + Intergenic
1069156687 10:65038219-65038241 CAGGAGGTGCCCCATCCACTTGG - Intergenic
1072143611 10:92613490-92613512 CATGAGGTGTTCTTTCTACAAGG - Exonic
1074108861 10:110408574-110408596 CACGAGGAGCAGCTTCCACAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079015942 11:16868760-16868782 AAGGAGGTGCATCTTCTCCTTGG + Intronic
1081948728 11:47023331-47023353 CAGGAGGTCCAGCTTCTGCAGGG - Intronic
1083354539 11:62056406-62056428 GAGGAACTGCACCTTATACATGG - Intergenic
1087691517 11:101325914-101325936 CAGTAGGTTCACCCTCTACTTGG - Intergenic
1088048809 11:105485555-105485577 CAGGAGGAGGACATTCTCCAAGG + Intergenic
1091970087 12:4779660-4779682 CTGGAGGTGCAGCTGCCACAGGG + Intronic
1095979891 12:47966103-47966125 CAGGAACTCCAACTTCTACACGG + Exonic
1102767531 12:115446546-115446568 AAGGAGGTGCAGCTTCTGCCTGG - Intergenic
1106464954 13:30005185-30005207 CAGGAGCAGCACCTTCCCCAAGG - Intergenic
1107671019 13:42746334-42746356 CTGAGGGTGCAGCTTCTACAGGG - Intergenic
1110256576 13:73440226-73440248 CAGGAAGTTCACTCTCTACACGG + Intergenic
1112703176 13:102035491-102035513 CAGTAGTCACACCTTCTACAAGG - Intronic
1113443204 13:110345884-110345906 CAGGGGGACCACCTTCTGCAAGG + Intronic
1116382959 14:44295190-44295212 GTGGAGGTACACCTTCTAAAGGG + Intergenic
1118818983 14:69332908-69332930 CAGGAAGTGTACCATCTACTGGG - Intronic
1119366179 14:74093663-74093685 CCGGAGTTGTACCTTTTACAAGG - Intronic
1121867068 14:97372474-97372496 AAGCTGGTGCACCTTCTCCAGGG - Intergenic
1121990543 14:98552776-98552798 CACCAGGGGCACCTTTTACATGG + Intergenic
1125721509 15:41847329-41847351 CAGGAGCTGCAACTGCTGCAGGG - Exonic
1126543006 15:49842604-49842626 CAGGAAGGGCATCTTCTATATGG - Intergenic
1129316621 15:74749184-74749206 CAGGAGGGGCACCTCCTCCAGGG - Intronic
1131150724 15:90045910-90045932 CCCGACGTGCCCCTTCTACAGGG - Intronic
1131672283 15:94632405-94632427 CAGAAGGTGAATCTTGTACAAGG - Intergenic
1132579173 16:677326-677348 CAGGCCGTGCACCATCTCCAGGG - Exonic
1133239259 16:4404809-4404831 CAGGAGGGGCAGTGTCTACAGGG - Intronic
1135278310 16:21132433-21132455 CAGGATGTGTACCTTCTTGAAGG + Intronic
1137956141 16:52831964-52831986 GAATAGGTGCACTTTCTACATGG + Intergenic
1138028739 16:53542352-53542374 CAGAAGGGGCACCTGCTTCACGG + Intergenic
1141036172 16:80628176-80628198 AAGGAGGTGCACATTCTACAAGG - Intronic
1141516022 16:84545634-84545656 CAGGACATGCACCTTTGACATGG - Intronic
1143407823 17:6689596-6689618 CAAAAGGTGCTCCTTCTACTGGG + Intronic
1144413866 17:15027309-15027331 CATGAGATGCCACTTCTACAAGG + Intergenic
1147389933 17:40102974-40102996 CAGGAAGCTCATCTTCTACAAGG - Intergenic
1147605417 17:41771475-41771497 GAGGAGGTGCAGCTACTTCAGGG - Intronic
1150803605 17:68301467-68301489 CAGGAGGTGGCCCTTCTGCTCGG - Intronic
1152209676 17:78996418-78996440 AAGGAGGTGCTGCTTCCACAGGG - Intronic
1152897680 17:82922713-82922735 GAGGAGGTGCGTCGTCTACAGGG - Intronic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1160157273 18:76443163-76443185 CAGGAGGTGCACCTTCTACATGG + Exonic
1162884840 19:13689210-13689232 GTGGAGTTGCACCTTCTACAGGG - Intergenic
1164649367 19:29880929-29880951 CAGGAGGCTCAGCTTCTAGAGGG + Intergenic
1165091909 19:33392128-33392150 CAGCAGGGGCACCATCTCCAGGG + Intronic
1167741985 19:51329321-51329343 CAGGAGTTGCCCTTTCGACAGGG - Exonic
926239914 2:11077556-11077578 CAGCAGGTGCTACTTCTAAATGG - Intergenic
927959950 2:27234956-27234978 CAGGAGGTGCTGCTTCCAAAAGG + Intronic
928768835 2:34680609-34680631 CAGGAGATGCAGCTTCTCCATGG - Intergenic
928935098 2:36668100-36668122 CATGAGCTGCTCCTTCCACATGG - Intergenic
929820486 2:45269449-45269471 CAGGAGCTGCTACTTCTACGGGG + Intergenic
935443863 2:103136222-103136244 CAGGACTTCCAACTTCTACATGG + Intergenic
935597272 2:104889049-104889071 AAGGAGGTGGGCCTTCTACATGG - Intergenic
936080028 2:109426542-109426564 GAGGAGTTGCTCCTTCTAGATGG + Intronic
938573746 2:132585348-132585370 CAGGAGGTGACTCTTCTCCAAGG - Intronic
940078908 2:149777974-149777996 TAGGATGTGCTCCTCCTACAGGG + Intergenic
943524465 2:188999299-188999321 CAGGAGGTCCACGTTCACCAGGG - Exonic
946032824 2:216718436-216718458 CAGGAGCTGCACCAGCCACAGGG - Intergenic
946135904 2:217646701-217646723 CAGCAGCTGCACTTTCTAGATGG - Intronic
948995819 2:241577703-241577725 CAGGAGGGGCACCTTGAGCATGG - Intergenic
1173257564 20:41405605-41405627 CGGGAGGTGCTCCTTGTACTGGG - Intronic
1174542852 20:51303634-51303656 CAGGAGGTGCTCCATCTACTTGG + Intergenic
1175514957 20:59563429-59563451 CAGAAGGGGCAGCTTCTGCATGG - Intergenic
1175786215 20:61713234-61713256 CAGGATGTGCACCTTGAACCTGG - Intronic
1175946969 20:62563484-62563506 GAGGAGGTGGTCCTCCTACACGG + Intronic
1176257648 20:64160501-64160523 CAGGGGGTGCACCTTCTCTCTGG - Intronic
1177875696 21:26628435-26628457 CAGGAGATGTATATTCTACAGGG + Intergenic
1178434965 21:32550023-32550045 CAGGAGAAGCACCTGCTACCAGG - Intergenic
1178905548 21:36633090-36633112 CAGCAGGTGCCTCTTCTGCATGG - Intergenic
1181919873 22:26312158-26312180 TAGAAGGTGCACCTTCTTCCAGG + Intronic
1182075140 22:27490398-27490420 CAGGAGGTGCAGCTGCTAGGTGG + Intergenic
955409894 3:58648766-58648788 CAGGAGGGGCACCCCCTGCAAGG - Intronic
959911631 3:111770162-111770184 CAGAGGAAGCACCTTCTACAAGG - Intronic
960157194 3:114307999-114308021 CAGCAGGTGCAGCTTCTGCCTGG - Exonic
974105514 4:57465656-57465678 CAGGAGATTCAAATTCTACATGG + Intergenic
974390621 4:61262068-61262090 CATGATGAGCACCTTCAACATGG - Intronic
980433526 4:132737586-132737608 CAGGAGGTGCTCCCTCCACTTGG - Intergenic
983173510 4:164561871-164561893 GAGGAGGTGAAATTTCTACAAGG - Intergenic
986305027 5:6508326-6508348 CAGGAGCTGCAACTTCTACCAGG - Intergenic
989585551 5:43071627-43071649 CAGGAGATGCCCCATCTACTCGG - Intronic
994658824 5:102628556-102628578 TCTGAGGTGCACCATCTACACGG + Intergenic
996087205 5:119317160-119317182 CAGGAGGTGCACCAGCCACAAGG - Intronic
996588187 5:125115233-125115255 CCAGAGGTGAACCTTCTTCATGG + Intergenic
1000658044 5:163906080-163906102 CAGGAAGTGAACCTTCCACCAGG + Intergenic
1000701049 5:164450741-164450763 CAGGAAGAGCACCTTTCACATGG + Intergenic
1001756240 5:174172513-174172535 CATGAGGTGCATAGTCTACAGGG + Intronic
1002777437 6:341097-341119 CTGGAGGTGCCCCTGCTGCAAGG + Intronic
1011517562 6:88168652-88168674 CTGGTGGTGCTCCTTCTATAAGG + Intergenic
1013422609 6:109979654-109979676 CAGGAGGTGCACGCCCAACAGGG - Exonic
1013994158 6:116287798-116287820 CAGGAGCTGCACCTTCCTTAAGG - Intronic
1016058037 6:139599443-139599465 CAGGAGGTGCAGTGTCTTCATGG - Intergenic
1017069344 6:150560281-150560303 AAGGAGGTGCACATTCTGTAGGG - Intergenic
1023929082 7:44693965-44693987 GTGGAGGAGCACCTTCCACAAGG + Exonic
1025731837 7:64114556-64114578 GAGGAAGTGCAGCTTCGACAGGG + Intronic
1025928040 7:65974736-65974758 GAGGAAGTGCAGCTTCGACAGGG - Intronic
1026537487 7:71252002-71252024 CAGCAGGGGCACCTTCTTCCAGG - Intronic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1031629763 7:124032674-124032696 CTGCAGGTACACCTTCTCCAGGG + Exonic
1031978814 7:128110962-128110984 CAGGTGGTGCACATTCTGAAAGG + Intergenic
1038883754 8:31640590-31640612 CAGCAGGTACATCTTCTTCATGG + Intronic
1039924437 8:41916194-41916216 CAGGAGGTGCCTCATCTACATGG + Intergenic
1046131810 8:109975282-109975304 CACGAGGTGGACCCTCGACAGGG - Intronic
1048581107 8:135730443-135730465 CAGGAGGTGCTCCCTCTTGAAGG + Intergenic
1050317687 9:4419979-4420001 CAGGTTGAGCACCGTCTACAGGG + Intergenic
1050932571 9:11349033-11349055 CAGGAGGTGCCCTGTCTACCCGG + Intergenic
1056114572 9:83429538-83429560 CAGGCTGGGCTCCTTCTACAAGG - Intronic
1058717118 9:107732670-107732692 CAGGAGGGGCAACTGATACATGG + Intergenic
1059369107 9:113810955-113810977 CAGGAAATGGACCTTCTAAAAGG - Intergenic
1060938871 9:127531965-127531987 CTGGAGGTTCACCTTTTCCAAGG - Intronic
1062606797 9:137352111-137352133 CAGGAGGTGGACGTTCTCCCTGG + Exonic
1186064850 X:5752068-5752090 CAGGAAATGTGCCTTCTACATGG + Intergenic
1186820865 X:13285952-13285974 CAGGGGGCACACCCTCTACACGG - Intergenic
1188896542 X:35675786-35675808 GAGGAAATGCACCTTCTGCAAGG - Intergenic
1195770621 X:108347295-108347317 GAGGATGTGCACCTTCCACATGG + Intronic
1199688047 X:150281673-150281695 CAGGAATTGCACCTTCCCCAAGG + Intergenic
1199858280 X:151777888-151777910 CTGGAAGTGCACCTTCCACTTGG + Intergenic
1200053559 X:153446967-153446989 CAGGTGGTGCACCTGCACCATGG + Intronic