ID: 1160159478

View in Genome Browser
Species Human (GRCh38)
Location 18:76460349-76460371
Sequence CCTCCCTGTTACCACCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160159470_1160159478 15 Left 1160159470 18:76460311-76460333 CCCTCGACAAGGCTGTGAGCCCA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283
1160159472_1160159478 -4 Left 1160159472 18:76460330-76460352 CCCATTCCCTGTCTTCCTGCCTC 0: 1
1: 0
2: 7
3: 116
4: 972
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283
1160159471_1160159478 14 Left 1160159471 18:76460312-76460334 CCTCGACAAGGCTGTGAGCCCAT 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283
1160159474_1160159478 -10 Left 1160159474 18:76460336-76460358 CCCTGTCTTCCTGCCTCCCTGTT 0: 1
1: 0
2: 7
3: 127
4: 1325
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283
1160159473_1160159478 -5 Left 1160159473 18:76460331-76460353 CCATTCCCTGTCTTCCTGCCTCC 0: 1
1: 0
2: 23
3: 319
4: 2503
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283
1160159469_1160159478 21 Left 1160159469 18:76460305-76460327 CCACATCCCTCGACAAGGCTGTG 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160159478 Original CRISPR CCTCCCTGTTACCACCTTCC AGG Intronic
900159505 1:1216756-1216778 CCTGCCCGTTGCCACCTGCCAGG + Intergenic
900373745 1:2344015-2344037 CTTCCCTGGGACCTCCTTCCCGG + Intronic
901659305 1:10788741-10788763 CCTGCCAGTGACCAGCTTCCAGG - Intronic
902334942 1:15749328-15749350 CCTCCCTAATGCCTCCTTCCTGG - Intergenic
904062231 1:27720760-27720782 GCTCACTGTAACCACCTCCCTGG + Intergenic
905028644 1:34867158-34867180 GTTCCCTGTGCCCACCTTCCAGG - Exonic
905218904 1:36430452-36430474 CATCCCTGTTGCCACCATCCTGG - Intronic
907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG + Intronic
907406486 1:54256788-54256810 CCTCCCTTCTACCCCCTTCTTGG - Intronic
908004727 1:59716117-59716139 CCTACCTGTTACCAGCTTTGTGG - Intronic
908182672 1:61621810-61621832 CCTCCCTGTTACATCCTCCAGGG - Intergenic
909250366 1:73345089-73345111 GCTCCCAGTTACCTCCTACCAGG - Intergenic
910847411 1:91616790-91616812 CCTCCTTGTTACCTGCATCCAGG - Intergenic
911104397 1:94118586-94118608 CCCACCTGCTACCACATTCCAGG - Intronic
911459483 1:98171628-98171650 CCTAACTGTTTCCATCTTCCTGG - Intergenic
912953079 1:114133996-114134018 CCTGCCTGGTGCCACCTGCCAGG + Intronic
913177496 1:116288264-116288286 CATCCCTGGTACCTCCCTCCTGG - Intergenic
915511467 1:156389048-156389070 CCTCCCTCTTAACCCCCTCCCGG + Intergenic
916735227 1:167601696-167601718 CTTTCCTGTTACCACTTTCTTGG + Intergenic
917620404 1:176789830-176789852 GCTCCCAGATTCCACCTTCCAGG - Exonic
917788587 1:178485526-178485548 CTATCCTATTACCACCTTCCAGG + Intergenic
919580061 1:199360352-199360374 CATCCCTTCTACCATCTTCCTGG + Intergenic
920242588 1:204563974-204563996 CCTACCTCCTACCAGCTTCCTGG - Intergenic
922776158 1:228215109-228215131 CCTCCCTGTTACAACCTACGGGG + Intronic
1063365258 10:5486690-5486712 CCTCCTGGTCAGCACCTTCCTGG + Intergenic
1064944202 10:20770240-20770262 CCACCCTGCTCCCACCTTCAAGG - Intergenic
1065795450 10:29303291-29303313 CCTGCCTGGTTCTACCTTCCTGG + Intronic
1067232442 10:44421554-44421576 CCTGCCTGTCACCTCCTTCCAGG + Intergenic
1067539998 10:47144230-47144252 CCTCTGTGTTGCCACCATCCAGG + Intergenic
1067878510 10:50024637-50024659 CCTCCCACTTGCCACCCTCCAGG + Intergenic
1067893214 10:50153292-50153314 CCTCCCACTTGCCACCCTCCAGG - Intergenic
1069886429 10:71626789-71626811 GATCCCAGTTACCACCTTCATGG - Intronic
1069958841 10:72067961-72067983 CCTCCCTCTGCCCACCTTCCAGG + Intronic
1072537085 10:96371908-96371930 CCTCTCTGTCTCCAGCTTCCAGG + Intronic
1073508082 10:104020098-104020120 GCTCTCTGTGACCACCATCCTGG - Intronic
1074114004 10:110442210-110442232 CCTGCCTGTCTCCACCATCCAGG - Intergenic
1074140351 10:110666988-110667010 CCTTTCTGTTGCCACCATCCTGG + Intronic
1074544699 10:114393571-114393593 CCTCCCTGTCCCCAGCCTCCAGG - Intronic
1076547423 10:131254621-131254643 CCTCTCTTTGCCCACCTTCCTGG - Intronic
1077340918 11:2025943-2025965 CCTCCCTTTTAGCATCTACCAGG - Intergenic
1083632825 11:64104524-64104546 CCTCACTGCTACCACCTTTAGGG - Intronic
1083764485 11:64835472-64835494 CCTCCCTGCCACCAGCTGCCTGG + Intronic
1083852400 11:65375984-65376006 CCTCCGCCTTTCCACCTTCCGGG - Exonic
1084115640 11:67041572-67041594 CCCTCCTGTTACGCCCTTCCAGG - Intronic
1084161896 11:67354735-67354757 CCTCCCCCTCACCAACTTCCTGG + Intronic
1084625966 11:70307368-70307390 CCTCCCTTTTTACAGCTTCCTGG - Intronic
1085312025 11:75522489-75522511 CCTCCCCGTCACCACCTCTCTGG + Intronic
1089200764 11:116723577-116723599 CCTCCCTGTTAGGAACTACCCGG - Intergenic
1089397301 11:118144882-118144904 TCTCCCAGTTACATCCTTCCTGG + Intronic
1089527104 11:119104371-119104393 CCTCCCTACCACCACCCTCCTGG + Intronic
1090501094 11:127262261-127262283 CATCCCTCTTACCACACTCCTGG - Intergenic
1090609317 11:128456102-128456124 TTTCCCTGTTTCCACTTTCCTGG - Intergenic
1090767399 11:129888101-129888123 CCGCCCTGTTACCACACTCAAGG - Intronic
1202823903 11_KI270721v1_random:81132-81154 CCTCCCTTTTAGCATCTACCAGG - Intergenic
1095434576 12:42173323-42173345 TCTTCCTGGTACCACCTGCCAGG - Intronic
1095473175 12:42558327-42558349 CCTCCCTTTTACACCCTTCATGG - Intronic
1096625799 12:52895368-52895390 CCTCCCTGCTTGCTCCTTCCAGG - Intergenic
1096839297 12:54370755-54370777 CCTCGCTGTTGCCCCTTTCCGGG - Intronic
1097208429 12:57344908-57344930 CCTCCACCTTTCCACCTTCCTGG + Intronic
1097693994 12:62759823-62759845 CCACCCTGTTTCCACTTTCCTGG + Intronic
1097694005 12:62759860-62759882 CCACCCTGTTTCCACTTTCCTGG + Intronic
1097784026 12:63738843-63738865 CCTCCCTGTTACTAGCTCCAGGG + Intergenic
1098073483 12:66700750-66700772 GCTCCCTGATACCAGCATCCTGG - Intronic
1100748140 12:97667942-97667964 CCTCCTTCTTCCCTCCTTCCTGG - Intergenic
1102213448 12:111143844-111143866 CCTCTCTGTCAGCACCTCCCAGG + Intronic
1107549427 13:41461084-41461106 CCTTCCTGTTCCCACTTTCAGGG + Intronic
1107832173 13:44384229-44384251 CGTCCCTGTTGCCACCTCTCTGG + Intronic
1110678343 13:78277468-78277490 CCTCCCTGGGATGACCTTCCAGG - Intergenic
1113568816 13:111339072-111339094 CCTCCCAGTTACCCCCGTCTTGG + Intronic
1115138913 14:30145374-30145396 TCTCCCTGATACCATCTTTCTGG - Intronic
1115307226 14:31945324-31945346 CTTCCCTGACACCACCTCCCTGG + Intronic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1116809194 14:49523251-49523273 CCACCCTGTTTCCATCTTCTTGG + Intergenic
1117670004 14:58096820-58096842 CCTCCCTGGTATCACATCCCAGG - Exonic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1118895832 14:69944409-69944431 CCTGCCTGTTACCACCCAGCAGG + Intronic
1119918849 14:78427344-78427366 CCTCCCTCCTCCCACCCTCCAGG - Intronic
1120180283 14:81336305-81336327 TATCCTTGTTACCACATTCCAGG + Intronic
1121273586 14:92653084-92653106 CCTCCCTGCCACCTCCTCCCAGG - Intronic
1121280010 14:92691343-92691365 CCTCCCTGTTCACACATCCCTGG + Intergenic
1122297237 14:100712462-100712484 ACTCCCTGTTGCCTCTTTCCCGG + Intergenic
1122636356 14:103131617-103131639 CCTCTCTGCCTCCACCTTCCAGG + Exonic
1123116964 14:105899219-105899241 CCTCCCTGGTTCCTCCTTCGGGG - Intergenic
1123121821 14:105920280-105920302 CCTCCCTGTTCACACCTTGAGGG + Intronic
1124395126 15:29294185-29294207 CCTCCCTGTTTCCTCATTCCTGG - Intronic
1124407977 15:29408656-29408678 CTTCCCTATTTCCAACTTCCTGG + Intronic
1126438759 15:48664485-48664507 CCTACCTGTGAGCACTTTCCTGG + Intergenic
1126801685 15:52303696-52303718 CCTCCCTCCTTCCATCTTCCAGG - Intergenic
1127765022 15:62177249-62177271 CTTCCCTATTTCCTCCTTCCTGG + Intergenic
1129237572 15:74232977-74232999 CCTCTCTGTTCCCGGCTTCCAGG + Intergenic
1129376822 15:75138736-75138758 CTTCCCTGTGTCCCCCTTCCAGG - Intergenic
1129942015 15:79506352-79506374 TCTTACTGATACCACCTTCCTGG - Intergenic
1130872688 15:87983742-87983764 CCTCCATTTCACCCCCTTCCTGG - Intronic
1131471845 15:92704439-92704461 CCTCCGTGGTACCACATCCCAGG + Intronic
1132754462 16:1475793-1475815 CCACCCTGTCCCCACCTTCTGGG + Intergenic
1132777633 16:1604575-1604597 ACTCCCTGCTCCCACCTCCCCGG - Intronic
1134304635 16:13021173-13021195 CCTCCCTCCTACCTCCTTCAGGG + Intronic
1134347286 16:13402585-13402607 GCTCACTGTAACCACCTCCCGGG + Intergenic
1134370889 16:13623503-13623525 CATCCCTGTTACCAGTTACCAGG - Intergenic
1134915240 16:18063801-18063823 CCTCCCTGTTGCCACTGTGCAGG - Intergenic
1135410190 16:22228204-22228226 CCTCTCTGTTGCCACATTCCAGG + Intronic
1136361435 16:29782482-29782504 CATCCCTGTTACCACTTTGAAGG + Exonic
1136925090 16:34364254-34364276 TCTTCCTGGTACCACGTTCCTGG + Intergenic
1136979483 16:35047552-35047574 TCTTCCTGGTACCACGTTCCTGG - Intergenic
1138634263 16:58324285-58324307 CCTCCCTCATAGCACCTACCAGG + Intronic
1139927240 16:70496379-70496401 CTTTCCTGCCACCACCTTCCAGG - Exonic
1140438023 16:74964484-74964506 CCTACCTCTGACCACCTCCCTGG - Intronic
1140787051 16:78352429-78352451 CCTTGCTGTTTCCAGCTTCCAGG + Intronic
1140985324 16:80153082-80153104 CCTCCCTCTTAACAGCATCCAGG + Intergenic
1141379465 16:83563119-83563141 TCTCCCTGTTGCGACATTCCAGG + Intronic
1141638395 16:85327891-85327913 CCTCCTTGATACCACATTCCTGG + Intergenic
1141829261 16:86500544-86500566 CCTGCCTGGGACCACCTCCCCGG - Intergenic
1143323429 17:6082648-6082670 CATCCCTGTCACCACCTCACTGG + Intronic
1143577376 17:7802130-7802152 ACTCCCTCTTCCCAACTTCCTGG - Intronic
1143698287 17:8637183-8637205 CCACCCTGCTCCCACCATCCCGG - Intergenic
1144240339 17:13304449-13304471 CCTCTCTGTTCCCCCCTTCCCGG - Intergenic
1146177828 17:30677878-30677900 ACTCCCTGCAATCACCTTCCAGG + Intergenic
1146490692 17:33279463-33279485 CCTCCCTCTTCCCATCCTCCTGG - Intronic
1146656885 17:34639750-34639772 CCTCCCTGTAACCACCTCTCAGG + Intergenic
1147602522 17:41755130-41755152 CCTCCCTGTCTCCAGCTGCCTGG - Exonic
1148999282 17:51740503-51740525 TCTCAATGTTACCACCTTCTTGG - Intronic
1149344863 17:55724525-55724547 CCCCCATCTTACCATCTTCCGGG - Intronic
1150020852 17:61611180-61611202 CCTCCTTGTTGCCCCTTTCCTGG - Intergenic
1151476804 17:74348793-74348815 TCTCCCTGCTCCCACCTTTCTGG - Intronic
1151495411 17:74455257-74455279 CAGCCCTCTCACCACCTTCCTGG - Intergenic
1151887607 17:76932469-76932491 CCGGCCTGTGACCCCCTTCCCGG - Intronic
1153688530 18:7568409-7568431 CCTCCCTGTCGCCCCCTGCCCGG + Intronic
1153692008 18:7603429-7603451 CCTGCCTGTTAACAGCTACCTGG + Intronic
1155150377 18:23118204-23118226 CCTTCCTGGACCCACCTTCCTGG - Intergenic
1155164683 18:23222776-23222798 CATCCGTGTTAGCACCTTCTGGG - Intronic
1156581553 18:38382443-38382465 CCTCCCTGATTACACCTTCTGGG - Intergenic
1157141440 18:45111113-45111135 CCTCCCTGTTCCCAGCCTCCAGG - Intergenic
1158083583 18:53624214-53624236 TCTCCCTGTTTACATCTTCCTGG + Intergenic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1160680375 19:409277-409299 CCTCCCTGCCACCAGCCTCCGGG - Intergenic
1161542677 19:4861440-4861462 CCTGCCTGGCCCCACCTTCCAGG + Intronic
1161737817 19:6002417-6002439 CCTCCCTGTGGCCATTTTCCTGG - Intronic
1161804061 19:6432141-6432163 CCTCCTTGTTATCCACTTCCAGG + Exonic
1163318135 19:16555450-16555472 CCTCCCTGTATCCACCTGGCAGG + Intronic
1163440065 19:17318126-17318148 CCTCCCAGTCTCCACCTCCCAGG + Intronic
1163731602 19:18952814-18952836 CTTCCCTGTGACCTCCGTCCGGG - Intergenic
1164694624 19:30234007-30234029 CCTTCCTGCCACCACCTACCTGG - Intronic
1165722723 19:38090963-38090985 CCTCCCTCTACCCACCTTTCTGG + Intronic
1167017491 19:46850595-46850617 CCGCCCTGTGCCCTCCTTCCCGG + Intronic
1167869952 19:52360031-52360053 CCTCCCTGCGACCAGCATCCAGG + Intronic
1168454492 19:56495737-56495759 CCCCTCTGTTGCCACCTTCAGGG - Intergenic
925332049 2:3066062-3066084 CCTCCCTGTAAACACCATCCAGG + Intergenic
925857309 2:8142188-8142210 CCTCCCTGAAAGCACCTTCCTGG - Intergenic
926392123 2:12404055-12404077 CCTGCCTCTTACCAGCTTCATGG + Intergenic
927353268 2:22144041-22144063 CCCCTCTGTTACCTCCTCCCAGG - Intergenic
929620867 2:43352760-43352782 CATCCCTACCACCACCTTCCAGG + Intronic
929889576 2:45907927-45907949 CCTCCCAGTTTTCACCTTCTAGG + Intronic
932502269 2:72193677-72193699 CCTACCAGTCACCACCTACCTGG - Intronic
933497946 2:83074951-83074973 CCTCACTCTTGCCACCATCCTGG + Intergenic
936628075 2:114170103-114170125 CCTCCCTGTTACCTCTTCCTTGG - Intergenic
938141724 2:128799959-128799981 CCTCCCTGTTCCCACCTCACTGG - Intergenic
939526067 2:143295964-143295986 CCTCGCTGTCACCACATTTCTGG + Intronic
940169749 2:150815705-150815727 CTTCCCTGTCTTCACCTTCCTGG + Intergenic
946116162 2:217464353-217464375 CCTCCTTTCTACCATCTTCCTGG + Intronic
947627253 2:231627741-231627763 CCTCCCTCCCACCACATTCCAGG + Intergenic
947837862 2:233188317-233188339 CCTCCCTGCCACCGCCTGCCAGG + Intronic
1169183874 20:3595217-3595239 CCTTCCTGTTTCAACCTACCAGG - Intronic
1169654993 20:7912853-7912875 CCTCCCTGTTACTACCAGGCTGG - Intronic
1169765910 20:9147837-9147859 CCTCCCTGTAACCACAGTCTCGG - Intronic
1172516113 20:35535000-35535022 GCTCACTGCAACCACCTTCCAGG + Intergenic
1172698304 20:36837107-36837129 CCTTCCTCTTTCCCCCTTCCTGG + Intronic
1172893009 20:38280358-38280380 GCTCACTGTAACCTCCTTCCAGG - Intronic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1173364669 20:42374004-42374026 CCTCTCTGCTCCCACCTCCCTGG - Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1173920559 20:46741634-46741656 CCTCCCTGCTACCAAATGCCAGG - Intergenic
1174173394 20:48630541-48630563 CCTCCCCATTCCCAACTTCCTGG - Intronic
1174285315 20:49468712-49468734 CCTCTCTCTTTCCACCTTCAAGG - Intronic
1174340427 20:49891766-49891788 CCTCCCTGCTTCCACCTGCATGG + Exonic
1174814856 20:53677876-53677898 CCTCTCTTTTGCCACCTGCCTGG + Intergenic
1175147964 20:56911008-56911030 CCTCTCTGTTCCCACCATCCTGG + Intergenic
1175514801 20:59562212-59562234 ACTCCTTGTTCCCACCTGCCTGG - Intergenic
1177751219 21:25286313-25286335 CATCCTTGTAACCACCATCCAGG - Intergenic
1178113782 21:29396535-29396557 CCTCCCTGTGGCAATCTTCCAGG + Intronic
1178546478 21:33496769-33496791 CCAGACTGTTAACACCTTCCAGG + Intergenic
1179395644 21:41038024-41038046 ACTGCCTGTTTCCACCATCCTGG + Intergenic
1179504953 21:41834210-41834232 CCTCCCTGATGCCTTCTTCCTGG - Intronic
1180098404 21:45572475-45572497 CCTCACTGATCCCAGCTTCCAGG + Intergenic
1181627322 22:24130702-24130724 CCTCCCTGTCAGCACCTATCTGG + Intronic
1181750020 22:24982777-24982799 CCTCCCAATTCCCAACTTCCAGG - Intronic
1181935808 22:26437566-26437588 CCTCCCTGGTAACATCTGCCTGG - Intronic
1182501834 22:30753560-30753582 CCTCCCATCCACCACCTTCCTGG - Intronic
1183080685 22:35454184-35454206 CTTCCCCTTCACCACCTTCCTGG + Intergenic
1183297297 22:37037805-37037827 CCTTCCTGTTTCCACCCTCCAGG - Intergenic
1183500514 22:38175967-38175989 GGTCCCTGTTATCACCTTCAAGG - Intronic
1183667177 22:39252845-39252867 CCTCCCTTTGAGCACTTTCCTGG - Intergenic
1184175218 22:42785190-42785212 CCTCCCTGTGAACAGCTTCCAGG - Intergenic
1185148781 22:49152808-49152830 CCTCCCTGTCACCCCCTCCCAGG + Intergenic
950268082 3:11590043-11590065 CCTGCATGTTAGCACCTTTCAGG - Intronic
953410653 3:42688795-42688817 CCTCCCTGCAATCACCTGCCGGG - Intronic
953903251 3:46855035-46855057 GCTCCCTGGAATCACCTTCCAGG + Intergenic
954360887 3:50122266-50122288 CCTCCCTCCTGCCACCTTCTGGG - Intergenic
955154009 3:56397889-56397911 CCTCCCAGTGTCCACATTCCAGG + Intronic
956329354 3:68088376-68088398 TCACACTGTTTCCACCTTCCTGG - Intronic
956636556 3:71371031-71371053 CCTCCCTGTAATCCCCTGCCAGG + Intronic
958135443 3:89483631-89483653 CATCTCTATTACCACCATCCTGG - Intergenic
963868010 3:150383679-150383701 CCTCCCTCATATCCCCTTCCAGG - Intergenic
964653644 3:159042170-159042192 CCTTCCTGTTACCACATACTCGG - Intronic
967844517 3:194033209-194033231 CCTCCCAGTGACCCCCTGCCAGG + Intergenic
967875827 3:194267972-194267994 CCTTCCTGGAACCTCCTTCCTGG - Intergenic
968620740 4:1602374-1602396 CCAGCCTGTCGCCACCTTCCTGG - Intergenic
969170189 4:5356070-5356092 CCTGGCTGTGACCACCTCCCTGG + Intronic
969738881 4:9009826-9009848 GCTCACTGCAACCACCTTCCGGG - Intergenic
971213396 4:24641157-24641179 ACTCTCTGTTACCACCTTTTTGG + Intergenic
973609626 4:52623116-52623138 CCTCCCTGCTACTCCCATCCTGG - Intronic
975844105 4:78506941-78506963 CCTCCATGTTACCATCTTTGTGG + Intronic
975921890 4:79400792-79400814 CCTCCCTGCTTCCACCTTTGTGG - Intergenic
977100444 4:92805941-92805963 TCTCCCTACTATCACCTTCCTGG + Intronic
982411665 4:155084698-155084720 CTTCCCTGGCTCCACCTTCCCGG - Intergenic
983298373 4:165894781-165894803 CCTTTCTGTTACTACCTTTCTGG + Intronic
984555433 4:181208504-181208526 CCTCATTTTTACCATCTTCCAGG - Intergenic
985561314 5:587589-587611 CCTCTCAGTACCCACCTTCCTGG + Intergenic
985684409 5:1274232-1274254 CCTTCCTGTTACTGCCTTCCAGG - Intronic
985841873 5:2312456-2312478 CCTTCCTTTTGCCTCCTTCCAGG + Intergenic
985982027 5:3478182-3478204 CCTCACTGTTCCCTCCTGCCTGG + Intergenic
985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG + Intergenic
986298250 5:6457056-6457078 CCTCCCTGATGCCACCTGCATGG + Intronic
986326132 5:6676063-6676085 CCTCCCTATTGCCAGCTCCCTGG - Intergenic
987384291 5:17314223-17314245 GCTCACTGTAACCACCTCCCAGG - Intergenic
987563534 5:19555380-19555402 CTTAGCTGTTACCAGCTTCCTGG + Intronic
988022706 5:25643695-25643717 TCTCCCTCTTTCCACCCTCCTGG - Intergenic
990544677 5:56811039-56811061 TCTTCCTTTTACCAACTTCCTGG - Intergenic
991702882 5:69332634-69332656 ACTCCCGGTTCCCACCTGCCAGG + Exonic
992377114 5:76198931-76198953 TCTTCCAGTTCCCACCTTCCAGG + Intronic
992452258 5:76885413-76885435 CCACCCTGTTCCCACTTTCCTGG - Intronic
992452270 5:76885449-76885471 CCACCCCGTTCCCACTTTCCTGG - Intronic
992452295 5:76885523-76885545 CCACCCCGTTCCCACTTTCCTGG - Intronic
992452334 5:76885634-76885656 CCACCCCGTTCCCACTTTCCTGG - Intronic
992452361 5:76885708-76885730 CCACCCCGTTCCCACTTTCCTGG - Intronic
992608629 5:78488041-78488063 CCTCACTGTTTCCTCCTTCCAGG - Exonic
992785812 5:80169555-80169577 TCTCCCTCTTACCCACTTCCCGG - Intronic
994823826 5:104687034-104687056 CCTTCCTGTTTCCTGCTTCCAGG - Intergenic
1001251542 5:170151088-170151110 CATCCCTGTTTCCAGCTGCCTGG - Intergenic
1001666908 5:173440828-173440850 CCTCTCTGTAGCCATCTTCCTGG + Intergenic
1001978589 5:176021471-176021493 CCTCCCAGGCACCACCTCCCTGG - Intronic
1002060147 5:176621058-176621080 CCTCCCTGCTCCCACCTCCTGGG + Intronic
1002238828 5:177822291-177822313 CCTCCCAGGCACCACCTCCCTGG + Intergenic
1004191881 6:13471252-13471274 CCTTCCCCTCACCACCTTCCTGG + Intronic
1004196261 6:13508401-13508423 CATCTGTGTAACCACCTTCCGGG + Intergenic
1004925015 6:20407915-20407937 CCTTGCTTTTACCACCTTTCAGG - Intronic
1005712673 6:28516910-28516932 GTTCCCTGTTATCTCCTTCCAGG + Intronic
1006116728 6:31779619-31779641 CCTCTGTGTTACCCCCTACCCGG - Exonic
1006994470 6:38245489-38245511 TCTCCCTGTTCCCATCTCCCTGG - Intronic
1007181904 6:39934584-39934606 GCTCCCTGTGCCCACTTTCCTGG + Intergenic
1007286805 6:40753720-40753742 CCTCCCTCTCTCCACCATCCTGG - Intergenic
1007553309 6:42746449-42746471 CCTCCCTACTACCCCCTTACAGG + Intergenic
1010811602 6:80306928-80306950 CCTCACTGTAACCACCATCTAGG - Intronic
1011215750 6:85004007-85004029 ACTCCCTTTTCCCACTTTCCAGG + Intergenic
1013363642 6:109418297-109418319 CCTGCCTCTTCCAACCTTCCTGG + Intronic
1014295331 6:119610597-119610619 CCTCCCTTTCAACATCTTCCAGG - Intergenic
1014629854 6:123774883-123774905 CCTCTCTGTTTCCACCTTCTCGG + Intergenic
1017088901 6:150741031-150741053 ACTCACTGTTGCCACCTTCTAGG - Intronic
1017994517 6:159520678-159520700 CTTCCCTGTTGACACCTTCAGGG - Intergenic
1018156564 6:160991393-160991415 CCACCCGGATCCCACCTTCCAGG - Intergenic
1018529902 6:164751539-164751561 CATCCCTGGTACTACCCTCCTGG + Intergenic
1019323108 7:424570-424592 TCTCCCTCCTACCTCCTTCCTGG + Intergenic
1019916997 7:4140069-4140091 TCCCCCTGTCACCACCTCCCTGG + Intronic
1020027114 7:4906979-4907001 CCTCTCTGTTACCAAAGTCCAGG - Exonic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1020494040 7:8824432-8824454 CTTCCCTGTTAACACCCTTCTGG + Intergenic
1021097659 7:16551663-16551685 CCCCCCGGGTACCACCCTCCAGG - Intronic
1022298212 7:29077477-29077499 ACTCCCTCTTTCCACCTGCCAGG - Intronic
1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG + Intergenic
1022639334 7:32166524-32166546 CTTCCCTCTTATCCCCTTCCTGG - Intronic
1023131953 7:37012295-37012317 CCTCCCTGTCACCTTCTCCCTGG - Intronic
1023515201 7:40994718-40994740 CCTCCCAGTCACCTCCTACCAGG - Intergenic
1024550986 7:50562223-50562245 CCTCACTTGTACCACCTGCCAGG - Intronic
1025141289 7:56468904-56468926 CTTCTCCTTTACCACCTTCCTGG - Intergenic
1025223675 7:57137989-57138011 CCACCCTGTAAACACGTTCCAGG - Intronic
1027744948 7:82061571-82061593 CCTCCCTGTAACCACCCAACAGG + Intronic
1029724142 7:102391020-102391042 CCTTCCTGGTGGCACCTTCCTGG - Intronic
1032151549 7:129434043-129434065 TTTCCCTGTTACCACCGACCCGG - Intronic
1034265088 7:149776903-149776925 CCTCCCCGTTTCCACCTGCTTGG + Intergenic
1034901032 7:154907907-154907929 CCTCCCTGCTCCCACCTCCTGGG + Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037745981 8:21644437-21644459 GTTCCCTGTTCCCATCTTCCAGG + Intergenic
1040369914 8:46759337-46759359 CTTCCCTGCTATCACCTCCCAGG + Intergenic
1040537004 8:48319255-48319277 CCTGCCTGTTTCCACTTTGCAGG + Intergenic
1045894354 8:107196280-107196302 CCTCCCTACTCCCACCTCCCAGG + Intergenic
1046920476 8:119722876-119722898 CCTCTCTTTTTCCTCCTTCCCGG - Intergenic
1047248255 8:123162484-123162506 GCTCTCTGTAACCACCTGCCAGG - Intergenic
1047821652 8:128527770-128527792 CCTCCCTTTTACAACCTCCCAGG - Intergenic
1047894759 8:129354215-129354237 CCCCCATGCCACCACCTTCCAGG + Intergenic
1048039493 8:130711737-130711759 ACTCTCTGTGACCACCTGCCTGG - Intergenic
1048104735 8:131395576-131395598 CCTCCATGGTACCACTGTCCTGG + Intergenic
1048524490 8:135189497-135189519 CCTCTGTGTAACCTCCTTCCTGG + Intergenic
1049163512 8:141112388-141112410 CCTCTCTGGTAGCACTTTCCTGG - Intergenic
1049462713 8:142737483-142737505 CCATGCTGTGACCACCTTCCTGG + Intergenic
1049686482 8:143941266-143941288 ACTCCCTGTGCCCACCTCCCTGG - Intronic
1050470665 9:5986121-5986143 CCTCCCTCTACCCACCTTACAGG + Intronic
1053042250 9:34884757-34884779 CCACCCTCTTGCCACCCTCCAGG - Intergenic
1053269013 9:36737188-36737210 CCTCTCTGTTACCCCTGTCCCGG + Intergenic
1060129251 9:121078899-121078921 CCTCCCTGTGTCCAGCTTTCTGG + Intronic
1061904667 9:133690568-133690590 CCTCTCTGTCCCCACCTCCCAGG - Intronic
1061989293 9:134149540-134149562 CCTCTCTGGTGCCACCCTCCCGG + Intronic
1203769717 EBV:43347-43369 CCCACCTGTTACCACATTCTAGG + Intergenic
1188479453 X:30622298-30622320 CCTCCCTGTAAACATCTTCCTGG - Intergenic
1188624067 X:32262785-32262807 CCTCCCAACTACCAGCTTCCGGG - Intronic
1189240834 X:39523125-39523147 CCTGCCTGCTGCCACCTCCCTGG + Intergenic
1189558949 X:42172904-42172926 CCTTCATATTACCACCTTGCTGG - Intergenic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1192201257 X:69068098-69068120 CCACCCTGCTTCCAGCTTCCAGG + Intergenic
1195291394 X:103434302-103434324 CCACCCTGTCTCCACTTTCCTGG - Intergenic
1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG + Exonic
1197234459 X:124043643-124043665 CCTTCCTTTTACAACATTCCAGG - Intronic
1201550804 Y:15214560-15214582 CCACCCTGTTTCCTGCTTCCAGG + Intergenic