ID: 1160160516

View in Genome Browser
Species Human (GRCh38)
Location 18:76466783-76466805
Sequence TGTGCGTGTCCCAGCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160160516_1160160519 -9 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160519 18:76466797-76466819 ACACGCACAGCTGATGCAACAGG No data
1160160516_1160160522 24 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160522 18:76466830-76466852 ACACAGAAGTCCCTCCACCAGGG No data
1160160516_1160160521 23 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG No data
1160160516_1160160520 -2 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160160516 Original CRISPR TGTGCGTGTCCCAGCAGGGA TGG (reversed) Intronic