ID: 1160160518

View in Genome Browser
Species Human (GRCh38)
Location 18:76466788-76466810
Sequence TCAGCTGTGCGTGTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160160518_1160160520 -7 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160518_1160160521 18 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG No data
1160160518_1160160522 19 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160522 18:76466830-76466852 ACACAGAAGTCCCTCCACCAGGG No data
1160160518_1160160524 29 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160524 18:76466840-76466862 CCCTCCACCAGGGTATCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160160518 Original CRISPR TCAGCTGTGCGTGTCCCAGC AGG (reversed) Intronic