ID: 1160160520

View in Genome Browser
Species Human (GRCh38)
Location 18:76466804-76466826
Sequence CAGCTGATGCAACAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160160514_1160160520 7 Left 1160160514 18:76466774-76466796 CCACGAGGGCCATCCCTGCTGGG No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160518_1160160520 -7 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160510_1160160520 25 Left 1160160510 18:76466756-76466778 CCTGGACATGCACAGGGGCCACG No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160509_1160160520 26 Left 1160160509 18:76466755-76466777 CCCTGGACATGCACAGGGGCCAC No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160517_1160160520 -6 Left 1160160517 18:76466787-76466809 CCCTGCTGGGACACGCACAGCTG No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data
1160160516_1160160520 -2 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160520 18:76466804-76466826 CAGCTGATGCAACAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160160520 Original CRISPR CAGCTGATGCAACAGGAGAC AGG Intronic