ID: 1160160521 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:76466829-76466851 |
| Sequence | GACACAGAAGTCCCTCCACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160160518_1160160521 | 18 | Left | 1160160518 | 18:76466788-76466810 | CCTGCTGGGACACGCACAGCTGA | No data | ||
| Right | 1160160521 | 18:76466829-76466851 | GACACAGAAGTCCCTCCACCAGG | No data | ||||
| 1160160516_1160160521 | 23 | Left | 1160160516 | 18:76466783-76466805 | CCATCCCTGCTGGGACACGCACA | No data | ||
| Right | 1160160521 | 18:76466829-76466851 | GACACAGAAGTCCCTCCACCAGG | No data | ||||
| 1160160517_1160160521 | 19 | Left | 1160160517 | 18:76466787-76466809 | CCCTGCTGGGACACGCACAGCTG | No data | ||
| Right | 1160160521 | 18:76466829-76466851 | GACACAGAAGTCCCTCCACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160160521 | Original CRISPR | GACACAGAAGTCCCTCCACC AGG | Intronic | ||