ID: 1160160521

View in Genome Browser
Species Human (GRCh38)
Location 18:76466829-76466851
Sequence GACACAGAAGTCCCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160160516_1160160521 23 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA No data
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG No data
1160160517_1160160521 19 Left 1160160517 18:76466787-76466809 CCCTGCTGGGACACGCACAGCTG No data
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG No data
1160160518_1160160521 18 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA No data
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160160521 Original CRISPR GACACAGAAGTCCCTCCACC AGG Intronic