ID: 1160160521

View in Genome Browser
Species Human (GRCh38)
Location 18:76466829-76466851
Sequence GACACAGAAGTCCCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160160517_1160160521 19 Left 1160160517 18:76466787-76466809 CCCTGCTGGGACACGCACAGCTG 0: 1
1: 0
2: 1
3: 12
4: 187
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 187
1160160518_1160160521 18 Left 1160160518 18:76466788-76466810 CCTGCTGGGACACGCACAGCTGA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 187
1160160516_1160160521 23 Left 1160160516 18:76466783-76466805 CCATCCCTGCTGGGACACGCACA 0: 1
1: 0
2: 2
3: 18
4: 223
Right 1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160160521 Original CRISPR GACACAGAAGTCCCTCCACC AGG Intronic
900151214 1:1180065-1180087 GACACCGGAGTCCCTCCTCCTGG - Exonic
900478987 1:2889296-2889318 GACACAGAAGAGCCACCCCCAGG + Intergenic
902282011 1:15381613-15381635 GGGACAGAATTCCCTCTACCAGG - Intronic
902364167 1:15960077-15960099 GACACTGAAGTCCTTCTCCCAGG + Intronic
902937363 1:19773887-19773909 GACTCTGAAGTCCAACCACCTGG + Intronic
904508731 1:30983172-30983194 CACACAGTATTCCCTCCAACAGG + Intronic
904841154 1:33372779-33372801 GAGACAGAAGGGTCTCCACCAGG + Intronic
905632722 1:39527567-39527589 GGGACAGCAGCCCCTCCACCTGG + Intergenic
905665094 1:39758850-39758872 GGGACAGCAGCCCCTCCACCTGG - Exonic
906097736 1:43235674-43235696 GAGATAGAAGTGCCTCCAGCTGG + Intronic
910669136 1:89755807-89755829 GAAACAGAAGTTTCTCCACAAGG - Intronic
911797064 1:102088961-102088983 TACACAGAAATGCCTCCAACTGG - Intergenic
912169441 1:107080714-107080736 GACACAGAAGTACCTCCCAGGGG - Intergenic
912945245 1:114079105-114079127 GACACACAAGTCCCATCACAGGG + Intergenic
913246402 1:116874035-116874057 GACACAGAAGCACCTCCCACAGG - Intergenic
915014935 1:152724133-152724155 GACCCTGAAGTCCCTGTACCAGG - Intergenic
915592679 1:156879509-156879531 GAGACAGAGCCCCCTCCACCAGG - Intronic
916261264 1:162844661-162844683 GACACAGAAAACCCTCCTCCTGG - Intronic
920665954 1:207963266-207963288 CAGACAGAAGTTCCTCTACCCGG - Intergenic
920711718 1:208301759-208301781 GAAACAGAAGTGCCTCTACATGG - Intergenic
923541553 1:234891762-234891784 GACACATAAGTCCTTCCAGGAGG + Intergenic
924580212 1:245316932-245316954 GTCTCGGGAGTCCCTCCACCCGG - Intronic
1062886837 10:1022985-1023007 GACCCAGAAATCCCACTACCAGG + Intronic
1063701208 10:8387033-8387055 AACAAAGAAAACCCTCCACCTGG - Intergenic
1065430842 10:25653860-25653882 GACACAGCAATCCCACCCCCAGG - Intergenic
1066733968 10:38455067-38455089 GACACAGAAATACCACGACCTGG - Intergenic
1068753233 10:60620543-60620565 GACTCTGGAGTCCCTCAACCTGG - Intronic
1069574360 10:69516410-69516432 GCCCCAGCAGTGCCTCCACCTGG + Intergenic
1075181445 10:120215257-120215279 AAGTCAGGAGTCCCTCCACCCGG - Intergenic
1076076247 10:127535975-127535997 AGCACAGGAATCCCTCCACCAGG - Intergenic
1076998026 11:308507-308529 GACACACAAGTCCCCACCCCAGG - Intronic
1076999247 11:314425-314447 GACACACAAGTCCCCACCCCAGG - Intronic
1077000620 11:320474-320496 GACACACAAGTCCCCACCCCAGG + Intronic
1077318828 11:1931606-1931628 AACACAGAGATTCCTCCACCAGG - Intronic
1078484101 11:11705982-11706004 GACCCTGGAGTCCCACCACCAGG + Intergenic
1080721646 11:34854999-34855021 AACTCAGAAGTCCCACCTCCTGG + Intronic
1081906282 11:46672464-46672486 GACCCAGAAGTCCCTACTCTTGG + Exonic
1084614561 11:70226938-70226960 GACACCCAGGTCCCTCTACCAGG + Intergenic
1088684142 11:112271035-112271057 GACCTAGAAGTCCCTTCCCCAGG + Intergenic
1089401116 11:118165189-118165211 GACACAGAGGCCCCTCCCACTGG + Exonic
1090394069 11:126407539-126407561 GTCACATCAGTCCCTCCGCCTGG + Intronic
1091840481 12:3616914-3616936 GACACAGCAGTTACTGCACCTGG + Intronic
1094856350 12:34404620-34404642 GAGGCAGAAGTCCCCCCACAAGG + Intergenic
1097103381 12:56605162-56605184 GACACAGGAGTCCCTCCTGCAGG + Exonic
1099199022 12:79653985-79654007 GACACAGTAGTACCTCCAACTGG - Intronic
1103417045 12:120749426-120749448 GCCACAGCATTCCCTCCTCCAGG + Intergenic
1106773471 13:32985401-32985423 CACACAGCTGTCCCTCCACAGGG - Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1109421192 13:62115136-62115158 GCCACAGGAGTCCCTACACCTGG - Intergenic
1112265679 13:97921198-97921220 GACAGAGAAGTCACTGAACCGGG - Intergenic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113455599 13:110446412-110446434 GACACAGATGGCGCTCCACGGGG + Intronic
1118707066 14:68490112-68490134 TGCACAGAAGTCCCTTCTCCAGG - Intronic
1202852162 14_GL000225v1_random:28492-28514 TACACAAAAGTCCCATCACCTGG - Intergenic
1202855861 14_GL000225v1_random:51918-51940 TACACAAAAGTCCCATCACCTGG + Intergenic
1125193906 15:37024471-37024493 TCCACAGAAGTTCATCCACCTGG + Intronic
1125414508 15:39438443-39438465 GACACAGAAGTGCCAGCACAAGG + Intergenic
1125751535 15:42032571-42032593 TATACAGAAGTCTCCCCACCCGG - Intronic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1133285705 16:4689666-4689688 CAAACAGAAGCCCCTGCACCTGG - Exonic
1134248419 16:12557124-12557146 GACACAGGAGTCACTGCCCCTGG + Intronic
1135026401 16:19002536-19002558 CTCACAGAAGGCCCTCCATCCGG - Intronic
1138412316 16:56850400-56850422 GTGACAGAAGTGCCTCTACCTGG + Intergenic
1138627245 16:58262055-58262077 CACACAGAAGTCCCTAAGCCAGG - Intronic
1139938746 16:70590087-70590109 GACACAGACGCCCCTCCCCTGGG - Intronic
1139972123 16:70782807-70782829 GACACAGAGGTCCTTTCACCTGG - Intronic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1140514465 16:75532152-75532174 GAGAAAGAACCCCCTCCACCTGG + Intronic
1141642829 16:85351251-85351273 GACAGAGAATTCCCTTCTCCAGG - Intergenic
1141697249 16:85625922-85625944 GCCACAGGAGTCCCTACCCCAGG - Intronic
1142884498 17:2904206-2904228 GACACTGGAGTCCCTCACCCGGG + Intronic
1148573643 17:48691575-48691597 GTGACTGAAGTCCCTCCACAGGG + Intergenic
1149952025 17:60998361-60998383 GACACAGAAATCCCACTACTGGG - Intronic
1151662576 17:75526331-75526353 GAGACCGAAGTCCCTCCCGCGGG - Intronic
1151933496 17:77247610-77247632 CACAGAGAAGTCCCACCGCCGGG + Intergenic
1152560437 17:81075985-81076007 GAAGCAGAAGTGCCTGCACCCGG + Intronic
1153221750 18:2868093-2868115 AAGTCAGGAGTCCCTCCACCCGG - Intronic
1153909770 18:9696557-9696579 AACAGAGAAGGCCCACCACCGGG - Intergenic
1155666103 18:28310479-28310501 GACCCAGAAATCCCTTCACTGGG + Intergenic
1156506751 18:37600705-37600727 GATACAGACATCCCTCCACTTGG - Intergenic
1157687061 18:49651047-49651069 GATGCAGGAGCCCCTCCACCTGG - Intergenic
1158000590 18:52613780-52613802 TACCCAGAATTTCCTCCACCTGG - Intronic
1158602934 18:58870545-58870567 TACACAGAAGTCCATCCTCAAGG - Intronic
1158843090 18:61409457-61409479 GACTCAGAAGTCACACCACTTGG + Intronic
1159390729 18:67789017-67789039 GACAGGGAAGTCCATCCCCCTGG + Intergenic
1160125751 18:76169782-76169804 GAAACAGGCCTCCCTCCACCTGG - Intergenic
1160160311 18:76465736-76465758 GGCACAGAAGTCCCTGCACCAGG + Intronic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160478036 18:79210415-79210437 GACACAGAAGACCCTCACCCAGG - Intronic
1163493821 19:17633047-17633069 GACACAGAGGTACAGCCACCTGG + Intronic
1164622334 19:29704014-29704036 GAGACTGAATTTCCTCCACCAGG + Intronic
1165153582 19:33774529-33774551 GATCCAGCAGTTCCTCCACCTGG - Intergenic
1167347579 19:48955849-48955871 GACCCAGAAGTCCAGCCACTGGG + Intronic
1167669301 19:50840481-50840503 GACACAGAAGTGCTTGAACCTGG + Intergenic
1167800767 19:51739878-51739900 TACTCTGAAGTCCCTGCACCTGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168455682 19:56506603-56506625 GGCACAGAAGTTCCTGCACTAGG + Intergenic
925841107 2:7993389-7993411 GTCACAGAAGTCCTTCTTCCTGG + Intergenic
927182306 2:20455288-20455310 GACCCAGAAATCCATCCAACTGG - Intergenic
927364585 2:22279206-22279228 GACCCAGCAATCCCACCACCAGG - Intergenic
927412565 2:22843920-22843942 GACACAGAAGAACCCCCACAGGG + Intergenic
932438072 2:71714815-71714837 GACAACAAAGTCCCTCCTCCTGG - Intergenic
935538707 2:104324739-104324761 GAAACAGAAGTCACACCACTGGG - Intergenic
936014295 2:108946103-108946125 GACACACCAGCCCCTCCTCCTGG + Intronic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
938562316 2:132484256-132484278 GACACAGAATTCTCTTTACCAGG - Intronic
939485420 2:142806226-142806248 GACACAGCAATCCCTCTACTGGG - Intergenic
945985744 2:216352233-216352255 GACACAGGAGTACCTCCATTTGG - Intronic
948199782 2:236121180-236121202 GAGACAGAAGAGCCTCCAGCTGG - Intronic
1171379467 20:24723359-24723381 TGCACAGAAGTCCCTGCAGCAGG + Intergenic
1172012345 20:31852911-31852933 AACAAAGAGGCCCCTCCACCTGG - Intronic
1174783740 20:53413264-53413286 GAAAGTGAAATCCCTCCACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1177295345 21:19166436-19166458 GAAACAGAAGCTCCTCCACTTGG + Intergenic
1177578279 21:22986448-22986470 GATACAGCAATCCCACCACCGGG + Intergenic
1178392914 21:32214098-32214120 AACACAGCAATCCCTCCACTGGG - Intergenic
1179251667 21:39675769-39675791 CACTCAGCAGCCCCTCCACCAGG - Intergenic
1181034948 22:20165405-20165427 GAGACAGGAGACCCTCCACTGGG - Intergenic
1181508872 22:23379954-23379976 GAGACAGGAGACCCTCCACTGGG + Intergenic
1183581888 22:38731230-38731252 ATCCCAGAAGCCCCTCCACCCGG - Exonic
1185341466 22:50293176-50293198 GGCATAGAACCCCCTCCACCAGG - Intronic
950159694 3:10750817-10750839 CACACAGTGCTCCCTCCACCTGG + Intergenic
952390051 3:32872333-32872355 CACACAGAAGTTACTCCACTCGG - Intronic
955348575 3:58178345-58178367 CACACAGTAGGCCCTCCGCCAGG + Intergenic
957674153 3:83345651-83345673 GCAACAAATGTCCCTCCACCAGG - Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
960698238 3:120416231-120416253 GACTCAGAAGTACCTGAACCTGG - Intronic
962461522 3:135618744-135618766 GATTCAGAAGTCCCTCCCCAGGG + Intergenic
963244826 3:143048040-143048062 AAGACAGAAGACCCTCCACTTGG - Intronic
963509696 3:146231374-146231396 GACCCAGAAGTCCCATCACTGGG - Intronic
963818520 3:149861261-149861283 GACCCAGCAGTCCCACCACTGGG + Intronic
968283325 3:197493421-197493443 CTAACAGAAGACCCTCCACCAGG + Intergenic
968383104 4:111711-111733 CTCACACAAGTCCATCCACCTGG - Intergenic
969257096 4:6009568-6009590 GGCTCTGAAATCCCTCCACCGGG - Intergenic
980043523 4:127965039-127965061 GACTGAGGGGTCCCTCCACCAGG + Intronic
983161356 4:164419579-164419601 GACCCAGAAGTCCCACTACTGGG + Intergenic
985853649 5:2408074-2408096 GACACAGAAATCCCTCTTCTGGG + Intergenic
986283820 5:6345554-6345576 GACACAGATGACCTTCCACTAGG + Intergenic
990058623 5:51618481-51618503 GACACACAAATCCTTCCGCCTGG + Intergenic
992675987 5:79106904-79106926 GACCCAGAGGTCCCTTCTCCTGG - Intronic
993676704 5:90823503-90823525 CAGACTGAAGTTCCTCCACCAGG - Exonic
996623690 5:125542053-125542075 TACAGAGAAGTACCTCCAACTGG - Intergenic
997733399 5:136196444-136196466 GAAACAGAAATAGCTCCACCAGG - Intergenic
998393870 5:141805872-141805894 GGCACAGCAGTCCCTCCCCGAGG + Intergenic
999265060 5:150261442-150261464 GACACGTCAGTCACTCCACCAGG - Intronic
1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG + Intergenic
1002690819 5:181049190-181049212 GACACAGCAATCCCACCTCCAGG + Intronic
1003509362 6:6766482-6766504 GGCTCAGAAGACCCTGCACCTGG - Intergenic
1004058320 6:12163823-12163845 GCCCCACAAGTCCATCCACCAGG + Exonic
1006039627 6:31243833-31243855 GACACATAATACCCACCACCCGG + Intergenic
1006401644 6:33821227-33821249 GACACAGATGCCCCTGCAACTGG - Intergenic
1008684656 6:53911683-53911705 GACACCGAAGCTCCTCCACCTGG + Intronic
1009417681 6:63433897-63433919 TACACAGAGGTTCCTCCACAGGG - Intergenic
1012364918 6:98427096-98427118 GACACAGAAGTTTCTCCACTTGG + Intergenic
1014978304 6:127916493-127916515 GACACAGAGGTCCTTCTGCCTGG + Intronic
1015000184 6:128204891-128204913 GACCCAGAAATCCCTCTACTGGG + Intronic
1019012373 6:168851996-168852018 TAAACAGAAGTCCCCCCATCTGG - Intergenic
1019157404 6:170048609-170048631 GACACCGAAGGTCCACCACCGGG - Intergenic
1019287381 7:230441-230463 GACACAGAGGTCCAGCCACGAGG - Intronic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1019394308 7:808773-808795 AACACAGAAGGCCTTCCTCCAGG - Intergenic
1020280585 7:6648131-6648153 GGCACAAAGGTCCCTACACCTGG - Intronic
1020551034 7:9604941-9604963 GACACAAAAGGCACTCCATCAGG + Intergenic
1021184571 7:17548472-17548494 GACACAGCATTCCCTCCCTCAGG + Intergenic
1023402038 7:39797656-39797678 GACGCAGAAGTACCACGACCTGG - Intergenic
1024306628 7:47934792-47934814 GACACAAGAGTACCCCCACCAGG + Intronic
1024317080 7:48030772-48030794 GACCCAGAAGTTCCTCCTCTGGG - Intergenic
1025128382 7:56363166-56363188 GACACAGAAGTACCACGACCTGG + Intergenic
1026896665 7:74013518-74013540 GGAACAGAAGCCCCTCCACAGGG + Intergenic
1027333256 7:77121944-77121966 GAGACTGAGGTCCCTCCGCCTGG - Intergenic
1029782534 7:102749358-102749380 GAGACTGAGGTCCCTCCGCCTGG + Exonic
1030232213 7:107220707-107220729 TAATAAGAAGTCCCTCCACCGGG + Intronic
1032724587 7:134578946-134578968 GACTCAGAAGTAAATCCACCTGG + Intronic
1034552688 7:151831736-151831758 CACACAGAACTCCCTCCAGGGGG - Intronic
1035099691 7:156386341-156386363 GCCACAGAAGTCCCTGCACAGGG + Intergenic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1039518602 8:38152991-38153013 GACACAGAACTCCCTCCCACAGG - Intergenic
1044153632 8:88815586-88815608 GACCCAGCAGTCCCACCACTGGG + Intergenic
1045378983 8:101604122-101604144 GACACAGAAGTCCTCCCATTGGG - Intronic
1046801476 8:118433095-118433117 GTCAGGGAAGTCCCTCCACAAGG - Intronic
1048159366 8:131999773-131999795 GACACAGAAAGCCCTCAGCCTGG - Intronic
1048911898 8:139143143-139143165 GCTACAGAAGTCCCTTCAACAGG - Intergenic
1049741798 8:144244577-144244599 GGCACAGAGGGCACTCCACCTGG + Intronic
1056678988 9:88700834-88700856 GACACAGCAGGCTCTCCAGCTGG + Intergenic
1060106871 9:120878039-120878061 CCCACTGAATTCCCTCCACCTGG - Intronic
1060962881 9:127693571-127693593 GAGACAGAAGTCCCTACAAAGGG - Intronic
1185433227 X:21438-21460 GAAACAGCAGTCCCTCCACTTGG + Intergenic
1185442429 X:233506-233528 GAAACAGCAGTCCCTCCACTTGG + Intergenic
1186137335 X:6533780-6533802 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137346 X:6533840-6533862 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186137356 X:6533900-6533922 GACTCAGTGGTTCCTCCACCTGG + Exonic
1186267078 X:7843779-7843801 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267088 X:7843839-7843861 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186267099 X:7843899-7843921 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324767 X:8466026-8466048 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324777 X:8466086-8466108 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324792 X:8466176-8466198 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324802 X:8466236-8466258 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186324811 X:8466296-8466318 GACTCAGTGGTTCCTCCACCTGG - Exonic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1195060809 X:101192107-101192129 GATCCAGAAGTCCCACTACCAGG - Intergenic
1197943777 X:131816644-131816666 GACACAAAAGCCCCACCTCCAGG + Intergenic
1199842403 X:151663557-151663579 GACCCAGCAGTCCCGCAACCAGG - Intronic
1201124974 Y:10904646-10904668 TAGACAAAAGTCCCTTCACCTGG - Intergenic
1201284774 Y:12369557-12369579 TGCACAGAAATCCCACCACCAGG - Intergenic