ID: 1160162498

View in Genome Browser
Species Human (GRCh38)
Location 18:76484470-76484492
Sequence AACACCGTGCTCTAAAATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160162495_1160162498 6 Left 1160162495 18:76484441-76484463 CCAAGTCAATGTAACACTCCTAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1160162498 18:76484470-76484492 AACACCGTGCTCTAAAATGGCGG 0: 1
1: 0
2: 1
3: 2
4: 84
1160162494_1160162498 23 Left 1160162494 18:76484424-76484446 CCTTCACGGTCATTACACCAAGT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1160162498 18:76484470-76484492 AACACCGTGCTCTAAAATGGCGG 0: 1
1: 0
2: 1
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160162498 Original CRISPR AACACCGTGCTCTAAAATGG CGG Intronic
903113360 1:21157330-21157352 AAAACAGTACTCTCAAATGGAGG - Intronic
909694536 1:78451476-78451498 AACACTGTGCCCTCATATGGTGG - Intronic
911469681 1:98301975-98301997 AATAACGGGCTCTAAAATTGTGG + Intergenic
915647512 1:157284295-157284317 AACACCGTGTCCTCACATGGTGG + Intergenic
915663159 1:157420316-157420338 AACACAGTGCCCTTACATGGCGG - Intergenic
916344478 1:163772410-163772432 AACACCCTGCTCCAAAAATGTGG - Intergenic
918398198 1:184137361-184137383 ATGACAGTGCTCAAAAATGGTGG - Intergenic
919484390 1:198129234-198129256 TAAACCTTGCTCTAAAATGTTGG + Intergenic
920591112 1:207220000-207220022 TTAACCTTGCTCTAAAATGGAGG - Intergenic
921076558 1:211704647-211704669 AGCACAGTGCTCTCAAAGGGTGG + Intergenic
1063287934 10:4710997-4711019 TACACCAAGCTCTAAACTGGAGG + Intergenic
1068118073 10:52756542-52756564 AAAAGCGTGCTCTGTAATGGTGG - Intergenic
1072423861 10:95312977-95312999 AAAACAGTGCTCTTAGATGGTGG + Exonic
1074456462 10:113599924-113599946 AACACAGTGCTCCAAAATGGGGG - Intronic
1075560145 10:123462117-123462139 ACCACCTGGCTCTAAAATGACGG - Intergenic
1082136201 11:48552020-48552042 AATAACAGGCTCTAAAATGGAGG - Intergenic
1087011919 11:93522615-93522637 AACAGCAAGCTCTACAATGGCGG - Intronic
1090638195 11:128706624-128706646 AACACCACGCTCTACAATGAGGG + Intronic
1093650612 12:21640807-21640829 AAGACAGTGCTCAAAAATGATGG + Intronic
1097376443 12:58848786-58848808 AACACCTGGCTCTAAAAGGTGGG + Intergenic
1097597494 12:61652563-61652585 AACAGGGTGCTTTAAATTGGGGG + Intergenic
1097677167 12:62615415-62615437 AACCCAGAGCTCTAAAATGCAGG - Intergenic
1097785797 12:63757625-63757647 AACACAGTCCTCTAAAACTGAGG + Intergenic
1099171143 12:79366116-79366138 AAGACAGTGCTGTAAAATGCAGG - Intronic
1109830371 13:67778613-67778635 CACACCTTACTCTAAAAGGGTGG + Intergenic
1111159186 13:84371228-84371250 AACCCCCTGCCCCAAAATGGTGG - Intergenic
1111872938 13:93856857-93856879 AACCACGTTCTCTTAAATGGAGG - Intronic
1112576080 13:100637801-100637823 AACACTGTGCTTTAAAAGGCTGG + Intronic
1120244102 14:81985607-81985629 AACATAGTGATCTAAAATAGAGG - Intergenic
1122579156 14:102760945-102760967 AAGGCCGTGCTCTGAAAAGGAGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1126712245 15:51472053-51472075 AACAGCCTGCACTAATATGGTGG + Intronic
1127323462 15:57869843-57869865 AACACAGAGCTGTAAAATGACGG + Intergenic
1130008823 15:80130441-80130463 GACATTTTGCTCTAAAATGGTGG - Intronic
1140160997 16:72494453-72494475 AACTCCGTTCTCTAGAATGAAGG + Intergenic
1143259586 17:5588124-5588146 AGAGCCGTGCCCTAAAATGGTGG - Intronic
1160162498 18:76484470-76484492 AACACCGTGCTCTAAAATGGCGG + Intronic
1164462779 19:28463118-28463140 AAAACCGTGCTGTGAAATGGAGG - Intergenic
1167032074 19:46969183-46969205 ATGACAGTGCTCTAAAATTGTGG + Intronic
931182836 2:59920350-59920372 AACATCCTGATTTAAAATGGCGG - Intergenic
944684240 2:202104312-202104334 AACACAGTGTTTTAAAATGCAGG + Intronic
947261121 2:228223637-228223659 AACAAAGTGCTATAAACTGGTGG - Intergenic
1172161968 20:32875165-32875187 AACACAGTGCTCCCATATGGCGG + Intronic
1174598869 20:51707904-51707926 ATCACCGTACTCTAGACTGGGGG - Intronic
1177720576 21:24901699-24901721 AACAAAATGCTATAAAATGGGGG - Intergenic
1178101235 21:29270815-29270837 ACCACTGAGCTCCAAAATGGAGG + Intronic
953206705 3:40837678-40837700 AACACTGTGTTCTCATATGGTGG + Intergenic
953281422 3:41561526-41561548 AACACCAGGCTCTGAAATTGAGG - Intronic
954736464 3:52711435-52711457 AACACAGAGCTATAAAATGCTGG - Exonic
959362997 3:105418546-105418568 AGTAACGTGTTCTAAAATGGAGG + Intronic
961695854 3:128704033-128704055 AACACCGTGGCCTCACATGGAGG - Intergenic
966985266 3:185174186-185174208 AACAGTGGTCTCTAAAATGGGGG + Intergenic
972574083 4:40335739-40335761 AAGACTGAGGTCTAAAATGGGGG - Intronic
972843080 4:42954360-42954382 ACCACCCTGTTCTAAAATAGTGG - Intronic
972968711 4:44545519-44545541 AAAACTCTTCTCTAAAATGGAGG - Intergenic
977201919 4:94126593-94126615 CACACAGTGCTCCAAAATGAGGG + Intergenic
985181747 4:187272279-187272301 AACGCTGTGTTCTAAAATTGAGG - Intergenic
989739536 5:44753894-44753916 AACACCGAGCTCTTAAACTGTGG + Intergenic
992621442 5:78597266-78597288 CACAGGGAGCTCTAAAATGGGGG + Intronic
994533522 5:100997773-100997795 AACACAGTGTTATAAAATGTTGG - Intergenic
998827140 5:146114199-146114221 AACAGCATGCTCAGAAATGGGGG + Exonic
999643731 5:153697904-153697926 CACACCGAGCTCTAAAATATTGG - Intronic
1001679715 5:173547313-173547335 AAAACCCTGCTCTAAAATGAGGG + Intergenic
1011283179 6:85697450-85697472 AACAACAGGCTCTAAAATTGAGG - Intergenic
1020957056 7:14752971-14752993 AAGGCCATGCTCTGAAATGGAGG + Intronic
1021651010 7:22833159-22833181 AACACAGTGCTATGTAATGGAGG + Intergenic
1026419073 7:70214165-70214187 AACTCTGTGCTCCAAACTGGTGG + Intronic
1028598167 7:92568884-92568906 AAGACATTGCTATAAAATGGGGG + Intronic
1031708661 7:125016015-125016037 AAGACAGTGCTAGAAAATGGAGG - Intergenic
1035074710 7:156169848-156169870 AACACCCTCCTCTGAAGTGGGGG + Intergenic
1044028173 8:87199711-87199733 AAACCCCTGCTCTAAAATGAGGG - Intronic
1053547731 9:39041527-39041549 AACACTGTGCCCGAAATTGGTGG + Intergenic
1060826019 9:126688549-126688571 AACCCGGTGCTCTGACATGGAGG - Intronic
1060887996 9:127169027-127169049 AACACCTTACTCTGAACTGGGGG - Intronic
1189321140 X:40088301-40088323 AAAATCGTGCGCTAAAATCGGGG + Intronic
1190180307 X:48185993-48186015 AACATCCTCCTCTAGAATGGTGG + Intergenic
1190189753 X:48267647-48267669 AACATCCTCCTCTAGAATGGTGG - Intronic
1190196965 X:48328207-48328229 AACATCCTCCTCTAGAATGGGGG - Intergenic
1190210513 X:48443180-48443202 AACATCCTCCTCTAGAATGGTGG - Intergenic
1190658509 X:52634151-52634173 AACATCCTCCTCTAGAATGGTGG - Intergenic
1190663698 X:52678586-52678608 AACATCTTCCTCTAGAATGGGGG - Intronic
1190675725 X:52779836-52779858 AACATCTTCCTCTAGAATGGGGG + Intronic
1194006590 X:88502025-88502047 AACACTGTCCTCTAAACTGCAGG - Intergenic
1198008297 X:132522328-132522350 AAAACCGAGAGCTAAAATGGAGG - Intergenic
1198693123 X:139306175-139306197 AACACTATGTTCTAACATGGAGG + Intergenic
1200623017 Y:5477678-5477700 AACAACGAGCTCTGAAATTGAGG - Intronic
1200683216 Y:6237382-6237404 AGCACCTGTCTCTAAAATGGAGG - Intergenic
1201049417 Y:9917004-9917026 AGCACCTGTCTCTAAAATGGAGG + Intergenic