ID: 1160162558

View in Genome Browser
Species Human (GRCh38)
Location 18:76484989-76485011
Sequence TGCCGTAGCAACGTAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160162558_1160162560 -6 Left 1160162558 18:76484989-76485011 CCCAAGTTTACGTTGCTACGGCA 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1160162560 18:76485006-76485028 ACGGCAAGCACTTTTACATTAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160162558 Original CRISPR TGCCGTAGCAACGTAAACTT GGG (reversed) Intronic
920020758 1:202954858-202954880 TGCCGTAGCCTGGAAAACTTGGG - Intronic
1088204983 11:107382094-107382116 TACCTTGGCAACGTAAACTCAGG - Intronic
1089958517 11:122595171-122595193 AGCCATAGCAACCAAAACTTTGG - Intergenic
1095730154 12:45497861-45497883 TGCTGTAGCAAAGTAAACAGCGG - Intergenic
1107736056 13:43399687-43399709 TCCCTTAGCTGCGTAAACTTGGG - Intronic
1107850250 13:44564414-44564436 TGACGTACCAATCTAAACTTAGG - Intronic
1114894770 14:26973806-26973828 TGCCATAGAAAGGTAAACTTTGG - Intergenic
1140108740 16:71984970-71984992 TGCAGTAGCCACTTAAGCTTTGG - Intronic
1144001147 17:11056419-11056441 TGCCTTAAAAAAGTAAACTTGGG + Intergenic
1160162558 18:76484989-76485011 TGCCGTAGCAACGTAAACTTGGG - Intronic
944185152 2:196940042-196940064 TGCCGTTGCTAACTAAACTTTGG - Intergenic
1175017335 20:55806209-55806231 CGCAGTAGCAACAGAAACTTGGG - Intergenic
1183665665 22:39244482-39244504 TGCCGTTGCAAAGCCAACTTTGG - Exonic
961945928 3:130687937-130687959 TGCCGTAGCAATGAACACATAGG - Intronic
963598912 3:147360439-147360461 TGCCTTACCAAATTAAACTTGGG - Intergenic
1002261724 5:177997850-177997872 GTCCATAGCAACGTAAAATTGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1023580273 7:41674732-41674754 TCCCATAGCAAAGTAAAATTGGG + Intergenic
1030724888 7:112915364-112915386 TGCCGTTGCAATGAAAAATTTGG - Exonic
1062300560 9:135865582-135865604 TGCAGTAGCAAAGAAAACTTCGG + Intronic
1192033635 X:67542134-67542156 TGTGGAAGCAACATAAACTTTGG + Intergenic
1202032631 Y:20593902-20593924 TGCAGTAACAACATAAAGTTAGG - Intergenic