ID: 1160164583

View in Genome Browser
Species Human (GRCh38)
Location 18:76498803-76498825
Sequence CTGTATTTGAATATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160164579_1160164583 11 Left 1160164579 18:76498769-76498791 CCTTTTCATGGAACTAAAAAATT No data
Right 1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG No data
1160164577_1160164583 23 Left 1160164577 18:76498757-76498779 CCTAAAATCTTTCCTTTTCATGG No data
Right 1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160164583 Original CRISPR CTGTATTTGAATATGGAGGA GGG Intergenic
No off target data available for this crispr