ID: 1160171261

View in Genome Browser
Species Human (GRCh38)
Location 18:76557370-76557392
Sequence AGGTGGAAACAGCTGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160171261_1160171264 -2 Left 1160171261 18:76557370-76557392 CCATGCTTCAGCTGTTTCCACCT No data
Right 1160171264 18:76557391-76557413 CTCACTGCTCAGCCTACTCATGG No data
1160171261_1160171266 21 Left 1160171261 18:76557370-76557392 CCATGCTTCAGCTGTTTCCACCT No data
Right 1160171266 18:76557414-76557436 CTTCACATTGTTATTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160171261 Original CRISPR AGGTGGAAACAGCTGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr