ID: 1160174517

View in Genome Browser
Species Human (GRCh38)
Location 18:76581639-76581661
Sequence GTGTGCATGAGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160174517_1160174523 11 Left 1160174517 18:76581639-76581661 CCTTCCTCCCTCCTCATGCACAC No data
Right 1160174523 18:76581673-76581695 GAATGCAAAGAGAAGCACAGAGG No data
1160174517_1160174524 20 Left 1160174517 18:76581639-76581661 CCTTCCTCCCTCCTCATGCACAC No data
Right 1160174524 18:76581682-76581704 GAGAAGCACAGAGGAGATGCAGG No data
1160174517_1160174525 27 Left 1160174517 18:76581639-76581661 CCTTCCTCCCTCCTCATGCACAC No data
Right 1160174525 18:76581689-76581711 ACAGAGGAGATGCAGGCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160174517 Original CRISPR GTGTGCATGAGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr