ID: 1160177046

View in Genome Browser
Species Human (GRCh38)
Location 18:76603456-76603478
Sequence TTTGAGGACTTCAAAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160177037_1160177046 21 Left 1160177037 18:76603412-76603434 CCTAGATATTCGAAGAAGAAAAC No data
Right 1160177046 18:76603456-76603478 TTTGAGGACTTCAAAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160177046 Original CRISPR TTTGAGGACTTCAAAGGTGG TGG Intergenic
No off target data available for this crispr