ID: 1160178144

View in Genome Browser
Species Human (GRCh38)
Location 18:76612651-76612673
Sequence GAGCCCTGCCCAAAAGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160178138_1160178144 26 Left 1160178138 18:76612602-76612624 CCAGGTTAAAATGTGCCGCTGAG No data
Right 1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG No data
1160178136_1160178144 28 Left 1160178136 18:76612600-76612622 CCCCAGGTTAAAATGTGCCGCTG No data
Right 1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG No data
1160178140_1160178144 11 Left 1160178140 18:76612617-76612639 CCGCTGAGTTACACAGAGAGGCA No data
Right 1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG No data
1160178137_1160178144 27 Left 1160178137 18:76612601-76612623 CCCAGGTTAAAATGTGCCGCTGA No data
Right 1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160178144 Original CRISPR GAGCCCTGCCCAAAAGCTCA TGG Intergenic
No off target data available for this crispr