ID: 1160178682

View in Genome Browser
Species Human (GRCh38)
Location 18:76616187-76616209
Sequence GAGGAAGGTGAAGTCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160178682_1160178684 -5 Left 1160178682 18:76616187-76616209 CCTTCACTGACTTCACCTTCCTC No data
Right 1160178684 18:76616205-76616227 TCCTCATTGCTAATTTCCAAAGG No data
1160178682_1160178689 30 Left 1160178682 18:76616187-76616209 CCTTCACTGACTTCACCTTCCTC No data
Right 1160178689 18:76616240-76616262 CCACTGTGCAGAAACCTTCTAGG No data
1160178682_1160178686 -4 Left 1160178682 18:76616187-76616209 CCTTCACTGACTTCACCTTCCTC No data
Right 1160178686 18:76616206-76616228 CCTCATTGCTAATTTCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160178682 Original CRISPR GAGGAAGGTGAAGTCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr