ID: 1160178685

View in Genome Browser
Species Human (GRCh38)
Location 18:76616206-76616228
Sequence CCCTTTGGAAATTAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160178685_1160178689 11 Left 1160178685 18:76616206-76616228 CCTCATTGCTAATTTCCAAAGGG No data
Right 1160178689 18:76616240-76616262 CCACTGTGCAGAAACCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160178685 Original CRISPR CCCTTTGGAAATTAGCAATG AGG (reversed) Intergenic
No off target data available for this crispr