ID: 1160178852

View in Genome Browser
Species Human (GRCh38)
Location 18:76617485-76617507
Sequence CACTGTGTCCTGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160178844_1160178852 18 Left 1160178844 18:76617444-76617466 CCGCCTTGTGTGGTCTGATCTCC No data
Right 1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG No data
1160178848_1160178852 -4 Left 1160178848 18:76617466-76617488 CCATTCTGGAGTAAGATAGCACT No data
Right 1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG No data
1160178845_1160178852 15 Left 1160178845 18:76617447-76617469 CCTTGTGTGGTCTGATCTCCCAT No data
Right 1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG No data
1160178847_1160178852 -3 Left 1160178847 18:76617465-76617487 CCCATTCTGGAGTAAGATAGCAC No data
Right 1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160178852 Original CRISPR CACTGTGTCCTGAGGGCAGA GGG Intergenic
No off target data available for this crispr