ID: 1160179715

View in Genome Browser
Species Human (GRCh38)
Location 18:76623756-76623778
Sequence CTGTGTGCTTGGAGCGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160179711_1160179715 -9 Left 1160179711 18:76623742-76623764 CCTCCACACATGCTCTGTGTGCT 0: 1
1: 0
2: 3
3: 12
4: 317
Right 1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG 0: 1
1: 0
2: 1
3: 23
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160179715 Original CRISPR CTGTGTGCTTGGAGCGAAGA GGG Intergenic
900607852 1:3531745-3531767 GTGTGTTCTTGGAGCCAACACGG + Intronic
902389019 1:16092022-16092044 CTGTGTGCCGGGAGCAAACAAGG - Intergenic
904123662 1:28220823-28220845 CTGTGTGCTTGGAGCCATGTTGG - Intronic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904424388 1:30414186-30414208 CTGTGTGGTTGGAGCATAGGAGG + Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912858004 1:113189102-113189124 CTTTGTGCTTGGAATGAAGGAGG + Intergenic
913489871 1:119368922-119368944 CTGTGTGCTTGGAACTGAGAAGG + Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
915102856 1:153513234-153513256 GTGGGTGCTTGGAGCAGAGAAGG - Intergenic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
922978619 1:229805764-229805786 CTAAGTGCTTGGAGGGAGGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923428308 1:233893596-233893618 CTGTGTGCTAGGTTCTAAGATGG - Intergenic
924718896 1:246605127-246605149 CAGTGTGCTTGGAATGAACAGGG + Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064735457 10:18377711-18377733 CTGTGTGGTTAGAGCGGGGAAGG + Intronic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1074936997 10:118191568-118191590 CTGAGTGCTTTGAGCTAAAATGG - Intergenic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075595289 10:123724895-123724917 CTGGGTGCTGGGAGAGAAGGTGG + Intronic
1076199028 10:128543361-128543383 CTGTGTGCTGGGAACGCAGCTGG - Intergenic
1076320867 10:129580478-129580500 CCGTGGGCTTTGAGCGAGGAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1077483340 11:2826761-2826783 CTATGTGCTTGGAGCCATGCTGG + Intronic
1080034715 11:27699877-27699899 CTGCGTGATGGGAGCAAAGACGG - Intronic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081796506 11:45824141-45824163 AGGTGTGCTGGGAGCGTAGATGG + Intergenic
1082313915 11:50694425-50694447 ATATGTGGTTGGAGCCAAGATGG + Intergenic
1084278051 11:68066230-68066252 CTGTCTGCTAGGAACAAAGAAGG + Intronic
1084800784 11:71542507-71542529 CTCTGTGCCGGGAGCCAAGAAGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1087198518 11:95322227-95322249 CTGTGGGCTTGGTGCCCAGAGGG - Intergenic
1090350610 11:126105534-126105556 CAGTGTGCTTGGAGCAGAGCAGG - Intergenic
1091701763 12:2667984-2668006 GTGTGTGCTGGGAAAGAAGAGGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1093211992 12:16318848-16318870 ATGTGTGCTTGCAGCTAAGGTGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1096423954 12:51485050-51485072 CTGTGTGTTTGGAGCAGAGTGGG + Intronic
1099088933 12:78280219-78280241 CAGTCTGCTTGGAGCCCAGAGGG - Intergenic
1099523349 12:83690393-83690415 CTGTGTGCTTGAGGGAAAGATGG - Intergenic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104031580 12:125068772-125068794 ACATGTGCTTGGAGAGAAGAGGG - Intronic
1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG + Intergenic
1108004794 13:45935563-45935585 CTGTGTGCATGCACCAAAGAAGG - Intergenic
1110074160 13:71217651-71217673 GTGAGTGCTTAGAGCCAAGAGGG + Intergenic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1119171494 14:72539409-72539431 CTGTGTCCTTAGAGCAAGGAGGG - Intronic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120840139 14:89078317-89078339 CTGAGTGCTTGGAGCCGGGAAGG - Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1121871414 14:97411499-97411521 CTGTGTGGTTAGAGCTAACATGG + Intergenic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1128453219 15:67819242-67819264 CTGTCTGGTTGGAGCAAAGAAGG + Intergenic
1129111835 15:73341656-73341678 CTATGTGCTGGGGGCCAAGAGGG + Intronic
1129779050 15:78257331-78257353 CTGAGGACTTGGAGCCAAGAAGG + Intergenic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130311035 15:82754521-82754543 GTGTGTGCTTGGGGAGTAGAAGG - Intergenic
1130765999 15:86871767-86871789 CGGAGTTCTTGGAGCCAAGATGG - Intronic
1132426171 15:101719214-101719236 GTGTGTGCTTGGAAAAAAGAAGG - Intronic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1140811670 16:78584921-78584943 CTGTGTGCTTTGACCGAGGCGGG - Intronic
1141845711 16:86607529-86607551 CTGTGTGTTGGGAGAGAAGGGGG - Intergenic
1142540556 17:655447-655469 CTGTCTGCCTGGAGTGAATATGG + Intronic
1142540567 17:655517-655539 CTGTCTGCCTGGAGTGAATATGG + Intronic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1149549295 17:57528035-57528057 CTGTGTGCCTGTGGCTAAGAAGG - Intronic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152525945 17:80888484-80888506 CTGTGTTGTTGGAGCGGAGTGGG + Intronic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155398780 18:25415923-25415945 CTCTGTGATAGGAGCTAAGAGGG - Intergenic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1156493258 18:37508874-37508896 CTGTATGCTTGGAGAGAGAAGGG + Intronic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1161540037 19:4844988-4845010 CTGTGTGGTTGGTGCAAAGAAGG + Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1164953778 19:32363056-32363078 CTGTGTGCTTTAAGCGGAGCTGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166265829 19:41683688-41683710 CTGTGTACTTGGACCTGAGAGGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
931052795 2:58432630-58432652 CTGTGTGCTTGGAGCAGGAATGG + Intergenic
935982174 2:108638421-108638443 CAGTGTGCTTGGTGCCATGAGGG + Intronic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936779386 2:116013920-116013942 CTGTGTGCTTCCAGGGATGATGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
940276883 2:151948863-151948885 CTGTGTGCTTGCAGAGTAGAAGG - Intronic
941253012 2:163190178-163190200 CTGAGTGCTAGAAGGGAAGAAGG + Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
948275386 2:236704291-236704313 CTGTGTGCTTGGACGCAAGTTGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1174750730 20:53108956-53108978 CTGAGTTCTTGGAGGGTAGAGGG - Intronic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1179355037 21:40651152-40651174 CTGTGTGCTTGGAGCTCATGAGG - Intronic
1179561459 21:42218787-42218809 CTGTGTGATGGGGTCGAAGAGGG - Intronic
1180176377 21:46092183-46092205 CTGTGTGCTCGGGGCCCAGATGG - Intergenic
1183334351 22:37238073-37238095 CTGTGTACTTGGAGTGAAGTGGG + Intronic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1184904394 22:47470925-47470947 CTGTGTCCTTGCAGCACAGAAGG + Intronic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
1185332653 22:50258628-50258650 CTGTTTGGTTGGGGTGAAGAGGG - Intronic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
953127224 3:40102915-40102937 CTGAGTGCTTGGCCCGTAGAAGG - Intronic
953520732 3:43640197-43640219 TTGTGTGCTTTGAGGGAACAGGG + Intronic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958949293 3:100399947-100399969 CTGAGTGCTTGCAGCCAAGGGGG + Intronic
959078715 3:101778517-101778539 CTCTGTGCTTGGAGCACAGTGGG - Intergenic
959739088 3:109695322-109695344 CTGTGAGCTTGGAGCTGAGGAGG - Intergenic
960021333 3:112957084-112957106 CTGTGTACTTGGGGGAAAGAGGG - Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
964784438 3:160379551-160379573 GTGTGTGCTGGGGGCGAGGAGGG + Intronic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
969391755 4:6896046-6896068 CTATCTGCTTGGAGCTGAGATGG - Intergenic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
973966859 4:56171866-56171888 CTGTGTGTTTGGAGCTATAAAGG - Intronic
974760600 4:66268510-66268532 CTGTGTCCTTGCACCTAAGATGG - Intergenic
975970613 4:80030428-80030450 CGGTGTGCTTGGGGTTAAGATGG + Intronic
976082942 4:81376048-81376070 CTGTGTGCTTGAGGCGGGGAGGG - Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
986454228 5:7899552-7899574 CTGTGTGCTTTGAGAGTGGAGGG + Intronic
989686197 5:44090085-44090107 CTGTGTTGTTGAAGCAAAGAAGG + Intergenic
990162334 5:52956132-52956154 CTGTGGCCTTGGAGAGAACATGG - Exonic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
1001922154 5:175609217-175609239 CTGAGTTCTAGGAGGGAAGATGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006595228 6:35188314-35188336 TTGTGTGCTTGGTACGTAGATGG - Intergenic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1007187507 6:39984855-39984877 ATATGTGCCTGGAGTGAAGAAGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1016295614 6:142570596-142570618 CTGTGTGCTTGGAGCTCACCAGG + Intergenic
1017785820 6:157756548-157756570 CTCTGTGCCTGGAGCAATGAAGG - Intronic
1018924079 6:168194517-168194539 CTGTGTTCTTGGAGGCTAGAGGG + Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1020796618 7:12685343-12685365 CTGTGTGCTTGGGGATAAAATGG - Intergenic
1021291591 7:18851932-18851954 CTGCCTGCAAGGAGCGAAGAAGG - Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023704627 7:42928752-42928774 CTATGTGTTTGGAGCAAGGAGGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1030259132 7:107544044-107544066 CTTTGTGCCTGGAGCCATGAGGG - Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1031328493 7:120433011-120433033 CTGTGTGATTGAAGCAAGGAGGG - Intronic
1032284986 7:130533012-130533034 CTGGGAGCTTGGAGAGCAGAGGG + Intronic
1032469073 7:132164939-132164961 CTGTGTCTTTGGAGCTATGATGG + Intronic
1032522211 7:132553938-132553960 CTGTGAGCTGGGAGCAAATAAGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033586559 7:142778905-142778927 CTCTTTGCTTGGGGCGAAGGGGG + Intergenic
1035288194 7:157819550-157819572 GTGTGTGCTTGGGGCGGGGAGGG - Intronic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035743919 8:1947902-1947924 CTCTATGCTTGGAGGGAAGCAGG - Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037901507 8:22691980-22692002 CTTTGTCCTCGGAGCGTAGAAGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1037929108 8:22867018-22867040 CTGTGTGATAGGAACGAAGAGGG + Intronic
1038024072 8:23573602-23573624 CTGTGTGCATGGTCCCAAGATGG - Exonic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1047784200 8:128137877-128137899 CTGTGTGCTGAGAGCTGAGATGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048522416 8:135169120-135169142 CTGTTTGCTTGGAGCTGACAGGG + Intergenic
1049299635 8:141862740-141862762 CTGTGTGGGTGCAGCGAAGCAGG + Intergenic
1049405669 8:142450906-142450928 CTCGGCGCTTGGAGCGGAGACGG - Intronic
1049570390 8:143367653-143367675 CTGTGTGCTTGTTGCGGAGCCGG + Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1053370858 9:37560508-37560530 ATGTGTGCTCGGAGTCAAGAGGG - Intronic
1056716936 9:89039238-89039260 CTGTGTGCTAGGAGCAATGCTGG - Intronic
1058316457 9:103573350-103573372 CTGTGTGCTTGGTGCTGAGCAGG - Intergenic
1058881728 9:109291250-109291272 GTATGTGCTTGGAGCTAAAAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062293373 9:135808703-135808725 CTGTGTGCGTGCACCAAAGATGG - Exonic
1186542849 X:10418802-10418824 CTGTGGGCTTGAACCTAAGAGGG - Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187897556 X:23997032-23997054 TTGCCTGCTTGGAGAGAAGAGGG - Intronic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1192192581 X:69000796-69000818 CTGTGTTCTTGGAGCTGAGTGGG - Intergenic
1193580112 X:83253381-83253403 CTGTGTGCTTTCAGAGATGAAGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197335086 X:125203366-125203388 CTGGGTGCTTGGGGTGAGGATGG - Intergenic
1199808904 X:151329552-151329574 CAGTGTTCTGGGAGCCAAGAGGG + Intergenic