ID: 1160183366

View in Genome Browser
Species Human (GRCh38)
Location 18:76655292-76655314
Sequence ACATTCACACCACAGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160183362_1160183366 18 Left 1160183362 18:76655251-76655273 CCACCTTGGGAGTTAGGATTTCA No data
Right 1160183366 18:76655292-76655314 ACATTCACACCACAGCCTTGTGG No data
1160183359_1160183366 28 Left 1160183359 18:76655241-76655263 CCAAATACCACCACCTTGGGAGT No data
Right 1160183366 18:76655292-76655314 ACATTCACACCACAGCCTTGTGG No data
1160183363_1160183366 15 Left 1160183363 18:76655254-76655276 CCTTGGGAGTTAGGATTTCAATG No data
Right 1160183366 18:76655292-76655314 ACATTCACACCACAGCCTTGTGG No data
1160183361_1160183366 21 Left 1160183361 18:76655248-76655270 CCACCACCTTGGGAGTTAGGATT No data
Right 1160183366 18:76655292-76655314 ACATTCACACCACAGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160183366 Original CRISPR ACATTCACACCACAGCCTTG TGG Intergenic