ID: 1160183421

View in Genome Browser
Species Human (GRCh38)
Location 18:76655671-76655693
Sequence GGTCCTGGAGGACCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160183421_1160183433 22 Left 1160183421 18:76655671-76655693 CCTGCTCCTGGTCCTCCAGGACC No data
Right 1160183433 18:76655716-76655738 CATGAGTTGTCTTCAAGAGGAGG No data
1160183421_1160183432 19 Left 1160183421 18:76655671-76655693 CCTGCTCCTGGTCCTCCAGGACC No data
Right 1160183432 18:76655713-76655735 TCTCATGAGTTGTCTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160183421 Original CRISPR GGTCCTGGAGGACCAGGAGC AGG (reversed) Intergenic
No off target data available for this crispr