ID: 1160188101

View in Genome Browser
Species Human (GRCh38)
Location 18:76691463-76691485
Sequence CTGTAACACCAGCAGTCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160188099_1160188101 -8 Left 1160188099 18:76691448-76691470 CCGCCTGTACACAGACTGTAACA 0: 1
1: 1
2: 1
3: 11
4: 118
Right 1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 244
1160188098_1160188101 18 Left 1160188098 18:76691422-76691444 CCTGAGTGATTTTTTAAAAATTT No data
Right 1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160188101 Original CRISPR CTGTAACACCAGCAGTCGTG AGG Intergenic
903533304 1:24048840-24048862 CTATAACTCCAGCATTTGTGAGG + Intergenic
904721060 1:32508899-32508921 CTCTTACAACAGCAGTCCTGGGG + Intronic
905332848 1:37219114-37219136 CTGTAACCCCAGCACTTGGGAGG + Intergenic
906469654 1:46117810-46117832 CTGTAACCCCAGCACTTGGGAGG + Intronic
908643910 1:66255906-66255928 CTGTAACTCCAGCACTTGGGAGG + Intronic
910817426 1:91306208-91306230 CTGTAATCCCAGCACTCGGGAGG + Intronic
910962053 1:92773082-92773104 CTGTAATCCCAGCACTCGGGAGG + Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
915389294 1:155526946-155526968 CTGTAATCCCAGCAGTTGGGAGG + Intronic
915394630 1:155573440-155573462 CTGTAATGCCAGCAGTTGAGAGG + Intergenic
916082496 1:161243737-161243759 CTGTAACTCCAGCACTTGGGAGG - Intergenic
917337608 1:173941676-173941698 CTGTAATACCAGCAGTTTAGGGG + Intronic
917832010 1:178901000-178901022 CTGTCAAATCAGCAGTCCTGTGG + Intronic
918030572 1:180804231-180804253 CTGTAATCCCAGCACTCGGGAGG - Intronic
919284738 1:195541972-195541994 CTGAAACACCAGCACTCTTGGGG + Intergenic
919631754 1:199966371-199966393 CTGTAACCCCAGCACTCTGGCGG + Intergenic
920134520 1:203758796-203758818 CTGTAACCCCAGCACTTGGGAGG + Intergenic
920348959 1:205325029-205325051 CTCTGCCACCAGCAGTCTTGGGG + Intergenic
922645651 1:227283933-227283955 CTGTAATCCCAGCACTCGGGAGG + Intronic
922650603 1:227334820-227334842 CTGTAATCCCAGCACTTGTGGGG + Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924174577 1:241377513-241377535 CTGTGACACCAGCTCTCGGGTGG - Intergenic
924185742 1:241488022-241488044 CTGTATCACTAACAGTCTTGTGG - Intergenic
924713069 1:246546490-246546512 CTGTAATCCCAGCATTCGGGAGG + Intronic
924808484 1:247380686-247380708 CTGTAATCCCAGCACTGGTGGGG - Intergenic
1062854160 10:771292-771314 CTGTCACACCCGCAGGAGTGAGG + Intergenic
1062891570 10:1064850-1064872 CTGTAATTCCAGCAAGCGTGAGG - Intronic
1063168005 10:3481095-3481117 CAGTATCACCAGCAGACATGGGG + Intergenic
1063275936 10:4568036-4568058 CTATAACAGCAGCAGTAGAGGGG + Intergenic
1063420327 10:5907220-5907242 CTGTAACCCCAGCACTTGGGAGG - Intronic
1066951620 10:42124067-42124089 TTGTAATACCAGCAGTTGAGGGG + Intergenic
1067732149 10:48820254-48820276 CCGGAACACCAGCAGTCCTGAGG + Exonic
1069376545 10:67798885-67798907 CTGTAATCCCAGCACTCGGGAGG - Intronic
1069533510 10:69236228-69236250 CTGTAATACCACCATTCGGGAGG - Intronic
1070014556 10:72512959-72512981 CTGTAACCCCAGCACTCTGGAGG - Intronic
1073151270 10:101313240-101313262 CTGTAATCCCAGCAGTTTTGGGG - Intergenic
1073468140 10:103706331-103706353 CTGTAAAACCAGCCCTGGTGAGG - Intronic
1074894901 10:117767388-117767410 CTGTAATACCAGCACTTGGGAGG + Intergenic
1074921508 10:118019233-118019255 TTGTAATTCCAGCAGTAGTGGGG - Intronic
1075496954 10:122929949-122929971 CTGTAACCCCAGCACTTTTGGGG + Intergenic
1077178667 11:1202738-1202760 CTGTCCCACCATCAGGCGTGGGG - Intergenic
1078258601 11:9683140-9683162 CTGTAATTCCAGCACTTGTGAGG + Intronic
1084469370 11:69347560-69347582 CTGTAATCCCAGCACTCGGGAGG - Intronic
1085259583 11:75196589-75196611 CTGCGACCCCAGCACTCGTGTGG + Exonic
1088201468 11:107339788-107339810 CTGTAATCCCAGCTGTTGTGGGG - Intronic
1088629564 11:111761700-111761722 CTGTAATCCCAGCCGTCGGGAGG + Intronic
1088658345 11:112023721-112023743 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1089615066 11:119690623-119690645 CTCTTACCCCAGCAGTCCTGAGG - Intronic
1091554782 12:1564516-1564538 CTGTAACCCCAGCACTGCTGGGG + Intronic
1092602204 12:10079562-10079584 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1092826810 12:12407964-12407986 CTGTAACCCCAGCATTTGGGAGG - Intronic
1093054888 12:14546194-14546216 CTGTAACCCCAGCACTTGGGTGG + Intronic
1093055359 12:14550620-14550642 CTGTAACCCCAGCACTTGGGAGG + Intronic
1093756672 12:22860425-22860447 CTGTAATCCCAGCATTTGTGAGG - Intergenic
1094599405 12:31895259-31895281 CTGTAATCCCAGCATTCGGGAGG - Intergenic
1095479402 12:42619845-42619867 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1095612623 12:44147676-44147698 CTGTAACCCCAGCACTTGGGAGG + Intronic
1096889870 12:54758736-54758758 CTGTAATACCAGCACTTGGGAGG - Intergenic
1097063903 12:56306148-56306170 CTGTAATCCCAGCAGTTTTGGGG - Intronic
1098344900 12:69491753-69491775 CTGTAAACCCAGCAGTTGAGAGG - Intronic
1101765087 12:107690583-107690605 CTGTAATCCCAGCATTCGGGAGG - Intronic
1101867869 12:108535562-108535584 CTGTAACACTAATAGTTGTGGGG - Intronic
1101920209 12:108926175-108926197 CTGTAATACCAGCAATTGGGAGG - Intronic
1101957455 12:109223498-109223520 CTGTAATCCCAGCACTCGGGAGG + Intronic
1102425804 12:112843564-112843586 CAGTAACACCGGCAATGGTGTGG + Intronic
1102510449 12:113411712-113411734 CTGTAATACCAGCACTTGGGAGG - Intronic
1103482267 12:121258452-121258474 CTGTAACCCCAGCACTTGGGAGG - Intronic
1103504656 12:121433920-121433942 CTGTAAGACCAGCACTTGGGAGG + Intronic
1104850508 12:131871266-131871288 CTGTAACTCCAGCACTTGGGAGG - Intergenic
1106021604 13:25920818-25920840 CTGTAACCCCAGCACTTGGGAGG + Intronic
1107444061 13:40454112-40454134 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
1108214756 13:48173226-48173248 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1108701501 13:52948023-52948045 CAGAGACACCAGCAGGCGTGGGG + Intergenic
1111073241 13:83197839-83197861 CTGTAATCCCAGCACTTGTGGGG + Intergenic
1111500708 13:89117374-89117396 CTGTAATCCCAGCATTCGGGAGG - Intergenic
1112446657 13:99470518-99470540 CTGTAACCCCAGCACTTGAGAGG - Intergenic
1112731161 13:102364414-102364436 CAGTAACTCCAACAGTAGTGGGG + Intronic
1114041610 14:18683847-18683869 CTGTAATCCCAGCAGTCTTGGGG - Intergenic
1116117747 14:40678840-40678862 CTGTAATCCCAGCAGTTGGGAGG + Intergenic
1117138568 14:52763147-52763169 CTGTAACCCCAGCACTCTGGGGG - Intronic
1117175518 14:53142347-53142369 CAGTTAAACCAGCAGTAGTGGGG - Intronic
1117232633 14:53736915-53736937 CTGCCACAACAGCAGTGGTGAGG - Intergenic
1117432659 14:55684755-55684777 CTGAAACCCCAGCACTCCTGGGG - Intronic
1118436865 14:65779534-65779556 CTGGAGCTCCAGCAGTCATGTGG - Intergenic
1119728948 14:76938932-76938954 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1124456270 15:29845680-29845702 CTGTAGCCCCAGCTGTCGGGAGG + Intronic
1126374991 15:47988707-47988729 AGGTAACACCTGCAGTGGTGTGG - Intergenic
1127476610 15:59339729-59339751 CTGTAATCCCAGCAGTTTTGCGG + Intronic
1130116225 15:81006767-81006789 CTGTAACCCCAGCACTTGGGAGG - Intergenic
1130931626 15:88432515-88432537 CTGTAACATCAGCAGTGGTTAGG - Intergenic
1133699214 16:8293625-8293647 CTGTAACAGCATCAGGGGTGGGG - Intergenic
1133947660 16:10362677-10362699 CTGCAACACCATCTGTGGTGAGG + Intronic
1135530347 16:23247680-23247702 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1136521303 16:30797898-30797920 CTGTAATGCCAGCACTTGTGGGG + Intergenic
1137817980 16:51417316-51417338 CTGGAACACTGGCAGTCCTGGGG + Intergenic
1137835255 16:51585987-51586009 CTGTAATACCAGCATTTGGGAGG - Intergenic
1139407359 16:66729696-66729718 CTGTAATCCCAGCAGTTGGGAGG - Intronic
1139757107 16:69152878-69152900 CTGTAATGCCAGCAATCGAGAGG - Intronic
1139878221 16:70163506-70163528 CTGCCACAGCAGCAGTGGTGGGG - Intergenic
1140359342 16:74331306-74331328 CTGCCACAGCAGCAGTGGTGGGG + Intergenic
1141042846 16:80687165-80687187 CTGAAACAGCAGCATTTGTGAGG + Intronic
1141497350 16:84419347-84419369 ATGTAACAGAAGCAGTGGTGCGG - Intronic
1145842724 17:28009715-28009737 CTGTAACGCCAGCAGTTTGGGGG - Intergenic
1146358338 17:32154182-32154204 CTGTAACCCCAGCACTTGAGAGG + Intronic
1148938806 17:51188879-51188901 CTGTAATCCCAGCACTCGGGAGG - Intronic
1149781034 17:59396768-59396790 CTGTAATCCCAGCAGGCATGAGG + Intronic
1149984844 17:61339507-61339529 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1151775370 17:76197688-76197710 CTGTAATCCCAGCACTCGGGAGG - Intronic
1152866716 17:82728365-82728387 CTGTAATCCCAGCACTCGGGAGG - Intronic
1154210518 18:12375786-12375808 CTGTAATCCCAGCAGGCGGGTGG - Intronic
1155222654 18:23699219-23699241 GTGTAACAACAACAGTCATGTGG - Intronic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1158593003 18:58793005-58793027 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1160188101 18:76691463-76691485 CTGTAACACCAGCAGTCGTGAGG + Intergenic
1160985954 19:1838858-1838880 CTGTAACCCCAGCACTTGGGAGG + Intronic
1161939267 19:7392591-7392613 CTGTAATTCCAGCACTCGGGAGG + Intronic
1162187265 19:8915346-8915368 CTGTAATACCAGCATTTGGGAGG - Intronic
1162939863 19:14002663-14002685 CTGTAGCACAAGCAGGCTTGTGG - Intronic
1163256714 19:16160500-16160522 CTGTAACCCCAGCATTTGGGAGG - Intergenic
1163302179 19:16454870-16454892 CTGTAACCCCAGCACTTTTGGGG + Intronic
1163889672 19:19999789-19999811 CTGTAACCCCAGCAATTGGGAGG - Intronic
1166033015 19:40147240-40147262 CTGTAATGCCAGCAGTTGGGAGG - Intergenic
1167108315 19:47444149-47444171 CTGTAACCCCAGCACTGGGGAGG - Intronic
928509326 2:31987254-31987276 CTGTAATACCAGCAGTGTGGGGG - Intronic
928871881 2:35989919-35989941 CTGTAACACATGCAGCCCTGTGG - Intergenic
929110915 2:38404428-38404450 CTGTAATACCAGCACTTGGGAGG + Intergenic
931275425 2:60739964-60739986 CTGTAATACCAGCATTTGGGAGG - Intergenic
931314294 2:61112748-61112770 CTGTAATCCCAGCAGTTGGGAGG - Intronic
931851120 2:66251594-66251616 CTGTAACAGGTGCAGTCATGGGG + Intergenic
933684111 2:85129643-85129665 CTGTAAAACCAGCACTTGGGCGG + Intergenic
934128136 2:88919101-88919123 GGGTAACACCAGGAGTCGTGTGG + Intergenic
934667269 2:96181211-96181233 CTGTAATCCCAGCAGTTTTGGGG + Intergenic
937587039 2:123565218-123565240 CTGTAGCACCAGCACTAGGGGGG + Intergenic
938013717 2:127849787-127849809 CTGTAATCCCAGCACTTGTGAGG + Intronic
938268599 2:129948674-129948696 CTGTAATCCCAGCAGTCTTGGGG + Intergenic
942030317 2:171953085-171953107 CTGTAACCCCAGCAGTTTGGGGG + Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
945030910 2:205662902-205662924 CTGGATCCCCAGCAGTTGTGAGG - Intergenic
946700048 2:222403335-222403357 CTGCTACACCAGCAGTCAGGTGG - Intergenic
946766701 2:223047254-223047276 CTGTAACACCAGCTATGCTGTGG - Intergenic
947514941 2:230795017-230795039 CTGTAATACCAGCATTTGGGAGG + Intronic
948490598 2:238310220-238310242 CTGTAATCCCAGCACTCTTGGGG - Intergenic
1172017877 20:31889675-31889697 CTGTAACCCCAGCATTTGGGAGG - Intronic
1173164893 20:40680999-40681021 CTGTAACACCAGCAGAAGCAGGG + Intergenic
1174314095 20:49683665-49683687 CTGTAATCCCAGCATTCGGGAGG - Intronic
1174489956 20:50885881-50885903 CTGTAATCCCAGTAGTCGGGAGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176032458 20:63019624-63019646 ATTTATCACCAGCAGACGTGCGG - Intergenic
1178885942 21:36484833-36484855 CTGTAATCCCAGCACTCGGGAGG - Intronic
1181027420 22:20134037-20134059 CGGCGACACCAGCAGTCTTGAGG + Intronic
1181904061 22:26179130-26179152 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1181955387 22:26584541-26584563 CTGTAACCCCAGCACTTGAGAGG + Intronic
1183226373 22:36552987-36553009 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1184084317 22:42250180-42250202 CTGTAATCCCAGCACTTGTGAGG + Intronic
1185302302 22:50088324-50088346 CTGTAATCCCAGCACTCGGGAGG + Intergenic
951492722 3:23290793-23290815 CTGTAATCCCAGCAGTTCTGGGG + Intronic
953820006 3:46199739-46199761 GTTTAACATCACCAGTCGTGGGG + Intronic
953908173 3:46878779-46878801 CTGCCACACCAGCAGGGGTGGGG + Intronic
955305143 3:57822992-57823014 AAGTAACAACAGCAGTCCTGGGG + Intronic
955618449 3:60834599-60834621 CTGTAATACCAGCATTTGGGAGG + Intronic
958598540 3:96262247-96262269 CTGTAATCTCAGCAGTCTTGGGG + Intergenic
958843609 3:99238794-99238816 CTGTAATCCCAGCACTCGGGAGG - Intergenic
959545544 3:107591742-107591764 CTGTAATACCAGCACTTGGGAGG - Intronic
959844409 3:111016709-111016731 CTGTAACCCCAGCACTTGAGAGG - Intergenic
960766873 3:121141145-121141167 CTGTAATCCCAGCACTTGTGAGG + Intronic
962228898 3:133642245-133642267 CTGTAATCCCAGCACTCGGGAGG - Intronic
963446720 3:145420548-145420570 CATTAACATGAGCAGTCGTGTGG + Intergenic
963892029 3:150646698-150646720 CTGTAATACCAGCACTTGAGAGG - Intergenic
963936871 3:151062739-151062761 CTGAAACTCCAGCAGTCATTTGG - Intergenic
966888312 3:184388720-184388742 CTGTATCACCTGCAGATGTGGGG + Exonic
966952052 3:184829471-184829493 CTGTAATACCAGCACTCTGGGGG - Intronic
968254223 3:197251126-197251148 CTGTAACCCCAGCATTTGGGAGG + Intronic
968312894 3:197698734-197698756 CTGTAATCCCAGCACTCGGGAGG + Intronic
970744129 4:19274677-19274699 CTGTAATCCCAGCACTTGTGAGG - Intergenic
973160781 4:47013414-47013436 CTGTAATCCCAGCACTCGGGAGG - Intronic
973761563 4:54121111-54121133 CTGTAATCCCAGCACTTGTGAGG - Intronic
974498928 4:62672317-62672339 CTGTAATTCCAGCACTCGGGAGG - Intergenic
974550952 4:63373786-63373808 CTGTAATCCCAGCACTCGGGAGG + Intergenic
977611099 4:99032486-99032508 CTGTAATACCAGCACTTGGGAGG - Intronic
977902231 4:102435994-102436016 CTGTAATACCAGCACTTGGGAGG + Intergenic
978587236 4:110287063-110287085 CTGTAATCCCAGCATTTGTGAGG + Intergenic
979674145 4:123392810-123392832 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
979861457 4:125698518-125698540 CTGTAATCCCAGCAATCTTGAGG + Intergenic
980343943 4:131587451-131587473 CTGTAGCACAATCAGTCCTGTGG + Intergenic
980968166 4:139544030-139544052 CTGTAACCCCAGCACTTGAGAGG + Intronic
982162173 4:152581286-152581308 CTGTAGTCCCAGCACTCGTGAGG + Intergenic
983374772 4:166911791-166911813 CTGTAACCCCAGCACTTGTGAGG - Intronic
983847483 4:172537976-172537998 TTGTAACCCCAACAGTCTTGGGG - Intronic
984002761 4:174270736-174270758 CTGTAATCCCAGCACTCGGGAGG - Intronic
985015526 4:185629815-185629837 CTGTAATCCCAGCAGTTGGGAGG - Intronic
985060452 4:186072565-186072587 CTGTAACCCCAGCACTTGGGAGG - Intronic
987981771 5:25095036-25095058 ATGTAACAGCAGCTTTCGTGAGG + Intergenic
989063162 5:37430815-37430837 CTGTAATCCCAGCAGTTGGGAGG - Intronic
991676244 5:69092340-69092362 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
992895406 5:81240900-81240922 CTTAAATACCAGCAGTCCTGGGG - Intronic
993554812 5:89322986-89323008 CTGTAATCCCAGCACTCGGGAGG + Intergenic
998116856 5:139544545-139544567 CTGTAATACCAGCACTTGGGAGG - Intronic
998851762 5:146357762-146357784 CTGTAATACCAGCATTTGGGAGG - Intergenic
999620046 5:153463583-153463605 CTGTAACTCCAGCACTTGCGGGG - Intergenic
1002694624 5:181076637-181076659 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
1003883306 6:10497850-10497872 CTGTAATCCCAGCACTCGGGAGG + Intronic
1005977180 6:30808617-30808639 CTATAATCCCAGCAGGCGTGAGG - Intergenic
1006867268 6:37219008-37219030 ATGAAACAGCAGCAGTGGTGTGG - Exonic
1007417189 6:41698645-41698667 CTGTTACACTCTCAGTCGTGGGG + Intronic
1007958001 6:45934536-45934558 CTGTATCACATGCAGTCTTGGGG - Intronic
1008100374 6:47384315-47384337 CTGTAATCCCAGCACTCGAGAGG - Intergenic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1008904174 6:56658021-56658043 CTATAATACCAGCAGTTGGGGGG - Intronic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1011473575 6:87731451-87731473 CTGTAATCCCAGCAGTAGTTTGG - Intergenic
1015582587 6:134741923-134741945 CTGTAATCCCAGCTATCGTGAGG + Intergenic
1022169714 7:27813591-27813613 CTGTAATCCCAGCACTTGTGAGG - Intronic
1023429238 7:40072381-40072403 CTGTAACTCCAGCACTTGGGAGG - Intronic
1023450702 7:40282051-40282073 CTGTAATCCCAGCACTCTTGAGG - Intronic
1025835507 7:65089605-65089627 CTGTAACCCCAGCACTCTGGGGG - Intergenic
1026317494 7:69239836-69239858 CTGTAATCCCAGCAGGCGTTTGG - Intergenic
1026500535 7:70939721-70939743 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1026722575 7:72844832-72844854 CTGTGACTCCAGGAGTTGTGGGG + Intergenic
1027024212 7:74839183-74839205 CTGTAATCCCAGCACTGGTGTGG - Intronic
1027063556 7:75104935-75104957 CTGTAATCCCAGCACTGGTGTGG + Intronic
1029687620 7:102159601-102159623 CTGTAATCCCAGCAGTCTGGGGG + Intronic
1030379344 7:108794789-108794811 CTGAAACACCAGGAGTCATTGGG - Intergenic
1034059186 7:148070458-148070480 CTGTAATCCCAGCACTCGGGAGG + Intronic
1035705000 8:1668782-1668804 CTGTAACCCCAGCAGGGCTGTGG + Intronic
1035957143 8:4093836-4093858 CTGTAATCCCAGCAATCGGGAGG + Intronic
1037889663 8:22617105-22617127 CTGTAATCCCAGCACTCCTGAGG - Intronic
1038177614 8:25195347-25195369 CTGTAATTCCAGCACTTGTGAGG - Intronic
1038799675 8:30738401-30738423 CTGTAATCCCAGCACTCGGGAGG + Intronic
1039027818 8:33277113-33277135 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1039252919 8:35686461-35686483 CTAGAACAACAGCAGTCCTGGGG + Intronic
1042195161 8:66225861-66225883 CTGTAACCCCAGCTATCGGGAGG - Intergenic
1042272978 8:66974295-66974317 CTGTAATACCAGCAGTTTGGGGG + Intronic
1047030000 8:120866343-120866365 CTCTATCACCTGCAGTTGTGTGG + Intergenic
1047735154 8:127758681-127758703 CTGTAACCCCAGCAGTCTGAGGG - Intergenic
1048036280 8:130680330-130680352 CTGTAGCAGCAGCTGTGGTGTGG + Intergenic
1051654040 9:19361118-19361140 CTGTAATCCCAGCAGTTGGGAGG - Intronic
1052178900 9:25501221-25501243 CTGTATCACTAGCAGTGTTGTGG - Intergenic
1053315195 9:37045162-37045184 CTGTAATCCCAGCAGTTGGGAGG + Intergenic
1053932622 9:43124100-43124122 CTGTAATACCAGCTGGGGTGGGG + Intergenic
1055925405 9:81505039-81505061 CTGTAATTCCAGCAGTTGGGAGG - Intergenic
1057820567 9:98327304-98327326 AAGTGACACCAGCAGTCGAGAGG - Intronic
1058213143 9:102198648-102198670 CTGTAATCCCAGCACTTGTGAGG + Intergenic
1059787365 9:117599844-117599866 CTGTAATCCCAGCAGTTTTGGGG + Intergenic
1059986823 9:119828307-119828329 CTGCAGCACCAGCAGACCTGGGG + Intergenic
1060330881 9:122669176-122669198 CTGTAATCCCAGCACTCTTGGGG - Intergenic
1060427335 9:123517361-123517383 CTGTAATCCCAGCACTCGGGAGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061172426 9:128967531-128967553 CTGTAATCCCAGCACTCGGGAGG + Intronic
1061953401 9:133949057-133949079 CTCTGACACCAGCACTCCTGGGG + Intronic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1201669199 Y:16497594-16497616 CAGTACCTCCAGCAGGCGTGGGG + Intergenic
1202304602 Y:23455194-23455216 CTGTAATACCAGCACTCTGGAGG - Intergenic
1202566208 Y:26215397-26215419 CTGTAATACCAGCACTCTGGAGG + Intergenic