ID: 1160191422

View in Genome Browser
Species Human (GRCh38)
Location 18:76717279-76717301
Sequence GCTGCTAGCAAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160191422_1160191427 13 Left 1160191422 18:76717279-76717301 CCTGCTTTATATTTGCTAGCAGC No data
Right 1160191427 18:76717315-76717337 CTCCCACCCCCCCGGATTGAGGG No data
1160191422_1160191430 16 Left 1160191422 18:76717279-76717301 CCTGCTTTATATTTGCTAGCAGC No data
Right 1160191430 18:76717318-76717340 CCACCCCCCCGGATTGAGGGTGG No data
1160191422_1160191426 12 Left 1160191422 18:76717279-76717301 CCTGCTTTATATTTGCTAGCAGC No data
Right 1160191426 18:76717314-76717336 CCTCCCACCCCCCCGGATTGAGG No data
1160191422_1160191424 5 Left 1160191422 18:76717279-76717301 CCTGCTTTATATTTGCTAGCAGC No data
Right 1160191424 18:76717307-76717329 AGATGGTCCTCCCACCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160191422 Original CRISPR GCTGCTAGCAAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr