ID: 1160198348

View in Genome Browser
Species Human (GRCh38)
Location 18:76776072-76776094
Sequence ACCGATGTGGTCCCACGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160198348_1160198352 -1 Left 1160198348 18:76776072-76776094 CCACAACGTGGGACCACATCGGT No data
Right 1160198352 18:76776094-76776116 TGTCTGGGCCTCAGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160198348 Original CRISPR ACCGATGTGGTCCCACGTTG TGG (reversed) Intergenic
No off target data available for this crispr