ID: 1160198357

View in Genome Browser
Species Human (GRCh38)
Location 18:76776144-76776166
Sequence AACACTGAGCTGTTCACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160198357_1160198360 25 Left 1160198357 18:76776144-76776166 CCTGACGTGAACAGCTCAGTGTT No data
Right 1160198360 18:76776192-76776214 CCTAGTTTATAATTTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160198357 Original CRISPR AACACTGAGCTGTTCACGTC AGG (reversed) Intergenic
No off target data available for this crispr