ID: 1160201774

View in Genome Browser
Species Human (GRCh38)
Location 18:76802029-76802051
Sequence CTTTCAACCCGGAAGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160201774 Original CRISPR CTTTCAACCCGGAAGGAACC TGG Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
1064734144 10:18363381-18363403 ATTTCAACCAGGAAGAAAGCGGG - Intronic
1068438335 10:57019255-57019277 CTTTGAAGCAGGAAGGAGCCTGG - Intergenic
1073555598 10:104447830-104447852 CCTGGAACCCGGAAGGAACAGGG - Intronic
1074526553 10:114268080-114268102 CTTTTAACATGGAAGGAAACTGG + Intronic
1075436778 10:122450326-122450348 ATTCCAGCCTGGAAGGAACCGGG - Intergenic
1078855365 11:15202186-15202208 CTTCCAACCCGGTGGGAAGCGGG - Intronic
1089398710 11:118152452-118152474 CTATGAACCAGGCAGGAACCAGG + Intronic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091265374 11:134266829-134266851 ATTTCAGACAGGAAGGAACCAGG + Intergenic
1092536799 12:9396270-9396292 CCTTCCACCTGGAAGGATCCTGG - Intergenic
1092557879 12:9577037-9577059 CCTTCCACCTGGAAGGATCCTGG + Intergenic
1096748445 12:53743671-53743693 CTGCCAACCCCGAAGGACCCAGG - Intergenic
1097340537 12:58432559-58432581 CTGACAACCGGGAAGGAACTTGG - Intergenic
1098854581 12:75637780-75637802 GTTTCAAGATGGAAGGAACCAGG - Intergenic
1103075516 12:117979307-117979329 CTTTAACCCCGGAAGGAAAAGGG + Intergenic
1105726152 13:23164424-23164446 CATTTAACACGGAAGGAAACTGG + Intergenic
1107792132 13:44013292-44013314 ACTACAACCCGGAAGGGACCAGG - Intergenic
1110778200 13:79433903-79433925 CTTTCAACTCGGTTGGAAACAGG + Intergenic
1116293279 14:43070671-43070693 CTCTCAAACCAGAAAGAACCAGG - Intergenic
1118266052 14:64295533-64295555 CTTTCAACCTGAGAGAAACCAGG - Intronic
1118842794 14:69525649-69525671 CATTCACCCCTGGAGGAACCAGG + Intronic
1125961309 15:43832155-43832177 CTTTCAACATTGAAGGAAGCTGG - Intronic
1128786895 15:70404212-70404234 CTTTCAATCCATAAGGAATCAGG + Intergenic
1128861927 15:71081417-71081439 TTTTGAACCAGGAAGGAACCTGG + Intergenic
1130058032 15:80545883-80545905 CCTTCACCCCGGAAGGATACAGG + Intronic
1133009634 16:2904008-2904030 CTTACAACCTGGAGGCAACCGGG - Intergenic
1133566071 16:6994673-6994695 CTCTCCACCCGAAAGGATCCTGG + Intronic
1137731388 16:50693329-50693351 GTTTCAACCAGGAGGGAATCGGG - Intergenic
1139597573 16:67967394-67967416 CTGTCAACCCTGCAGGAAACAGG + Intronic
1141241267 16:82267157-82267179 CTTTCCAACCGAAAGGAACTTGG - Intergenic
1143905658 17:10207276-10207298 CTTGCAGTCCGGAAGAAACCTGG + Intergenic
1144851616 17:18246821-18246843 CTTCCAACCCGGCAGGTACTGGG - Exonic
1148667888 17:49388310-49388332 CTACCAACCCGGCAGGCACCTGG + Intronic
1152086799 17:78224873-78224895 GTTTCTGCCCGGAAGGAGCCCGG - Exonic
1153425210 18:4955195-4955217 CTTACAAGCCAGAAGGAACTGGG + Intergenic
1153839656 18:8995010-8995032 CTTTCAACCCTGAAGAAGCGTGG - Intergenic
1154382515 18:13865512-13865534 CTTTCAACCAGCAAAGAAACAGG + Intergenic
1160201774 18:76802029-76802051 CTTTCAACCCGGAAGGAACCTGG + Intronic
1168534619 19:57158613-57158635 CCTTCCACCTGGAAGGAACCTGG - Intronic
926723975 2:15983384-15983406 CTCTGAAGCAGGAAGGAACCAGG + Intergenic
931299934 2:60969666-60969688 TTTTCAACCCAGAATGAACTAGG + Intronic
933773544 2:85758617-85758639 CTCTCAACCAGGAAGGGAGCAGG + Intronic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
937175902 2:119934811-119934833 CATTCACGCAGGAAGGAACCCGG + Exonic
940275515 2:151936639-151936661 CTTTTATCCCTGAAGGAAGCAGG - Intronic
941404730 2:165074478-165074500 CTTTCAAGCCTGCAGGGACCAGG - Intergenic
941636663 2:167942178-167942200 CCTTCAACCTGGATGGACCCGGG + Intergenic
948228428 2:236331652-236331674 CTTTCAACCGAGAGGGAAACTGG - Intronic
949007762 2:241659627-241659649 GCTGCAACCCTGAAGGAACCTGG + Intronic
1169088510 20:2841739-2841761 CTTTCAGCCCTGAAGGAGCCTGG - Intronic
1169623091 20:7529937-7529959 CTTTGCACCCTAAAGGAACCAGG + Intergenic
1172397524 20:34619485-34619507 CTTTCAATCCGTAGAGAACCAGG - Intronic
1176664314 21:9670434-9670456 CTTTCTACCCGGAAGCCACTAGG - Intergenic
1182278612 22:29205796-29205818 CTGCCAACCCGGAAGGAGCCCGG - Intergenic
1182998007 22:34832097-34832119 CTTTGAATCAGGATGGAACCAGG + Intergenic
956387466 3:68735326-68735348 CTCTCAACAGGGAGGGAACCTGG + Intronic
956825564 3:72994649-72994671 CTTTCAGACTGGAAGGGACCTGG + Intronic
958997932 3:100927301-100927323 CTTTGGAGCCAGAAGGAACCAGG + Intronic
960170109 3:114450951-114450973 TTTTCAACCAGGAACGAAACAGG - Intronic
962833135 3:139161565-139161587 CTTTTAACCAACAAGGAACCTGG + Intronic
965291165 3:166882871-166882893 CTTACAAGCCAGAAGGAACTGGG + Intergenic
965561260 3:170064217-170064239 CTTTCAACCCAGCAGGACGCGGG - Intronic
965668414 3:171120732-171120754 GTCTCAACCCAGAAGGAACCTGG - Intronic
973075723 4:45923473-45923495 CTTTCCACCCATAATGAACCTGG - Intergenic
979440788 4:120747913-120747935 ATTTCAACATGGAAGGCACCTGG - Intronic
980087046 4:128402437-128402459 CTTACAAACTGGAAGGAATCGGG - Intergenic
981722894 4:147819639-147819661 GTGTGAACCCGGGAGGAACCCGG - Intronic
989260998 5:39420362-39420384 CTTTCAACCTAGAAGAAATCTGG - Intronic
990792276 5:59495651-59495673 CTTGCCACCCAGAAGAAACCTGG - Intronic
992006125 5:72479134-72479156 CTTTGGACCTGGAATGAACCTGG - Intronic
994131994 5:96240482-96240504 ATTTCAACTGGGAAGGAAGCTGG - Intergenic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
999459580 5:151746356-151746378 CTTGCAACCCTGAAGAAAACAGG - Exonic
1011879519 6:92007287-92007309 CTTTCATCCTGGAAGAAAACTGG - Intergenic
1014421187 6:121247136-121247158 CTTACAAGCCAGAAGGAACTGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027164569 7:75825338-75825360 CTTTCAACCTGGTAGTTACCTGG - Intergenic
1033130526 7:138741790-138741812 CTTTCAACCATCAAGGAAGCAGG + Intronic
1035067660 7:156119986-156120008 GTTTCAACCTGGAGGGAAACAGG - Intergenic
1038054889 8:23848977-23848999 CTTTCAACCCTGTGGGAAGCAGG - Intronic
1038208255 8:25490048-25490070 CATTAAATCCGGAAGGAACTAGG + Intronic
1040305798 8:46211159-46211181 CTTTCATCCCAGAAGAATCCAGG + Intergenic
1040311461 8:46238986-46239008 CTTTCATCCCAGAAGTCACCAGG + Intergenic
1041006334 8:53499972-53499994 CTATCAACAGGGAAGGAAACAGG - Intergenic
1044435547 8:92158460-92158482 CTATCAACCAGGATGAAACCAGG + Intergenic
1054826951 9:69582782-69582804 CTTTCATAGCGGAAGGAACTGGG - Intronic
1057478986 9:95429322-95429344 CCTTCACACCGGGAGGAACCTGG - Intergenic
1060515274 9:124261732-124261754 CTTTCAACACCGAAGGACACTGG - Intronic
1203661787 Un_KI270753v1:51318-51340 CTTTCTACCCGGAAGCCACTAGG + Intergenic
1187745868 X:22408731-22408753 TTTTAAACCCTGAAGGAAACTGG + Intergenic
1190927282 X:54921377-54921399 CTTTCAAACCGGAACCAACCGGG - Intronic
1191836821 X:65472139-65472161 CTTACAAGCCAGAAGGAACTGGG - Intronic