ID: 1160201956

View in Genome Browser
Species Human (GRCh38)
Location 18:76803009-76803031
Sequence CAGTGGCAATGTAATTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160201953_1160201956 -4 Left 1160201953 18:76802990-76803012 CCAAATACTTCAGAGGTACCAGT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1160201956 18:76803009-76803031 CAGTGGCAATGTAATTAATGAGG 0: 1
1: 0
2: 2
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160201956 Original CRISPR CAGTGGCAATGTAATTAATG AGG Intronic
901381658 1:8878567-8878589 CAGTGGCTAGGTAATGATTGGGG - Exonic
904452514 1:30623290-30623312 CAATAGCAATGTAACTAATTTGG - Intergenic
904875103 1:33648390-33648412 CAGTGGAAATTTAAAAAATGTGG + Intronic
909406703 1:75298339-75298361 CAGTGGCACTGGGATTAATCTGG + Intronic
911396120 1:97312946-97312968 AAGTGGCATTGTAGGTAATGTGG + Intronic
912106672 1:106285917-106285939 CAGTGACACAGTAATTAATACGG + Intergenic
917855220 1:179094099-179094121 CAGGGGCGATATAATCAATGAGG + Exonic
919242139 1:194927868-194927890 CAATTGCAATGTATTTAATCAGG + Intergenic
924544567 1:245014416-245014438 CAGTGTAAATTTAAATAATGAGG + Intronic
924794212 1:247280923-247280945 CAGTGGCGATGTAATGAAAGTGG - Intergenic
1064961761 10:20973072-20973094 AACTGACACTGTAATTAATGTGG - Intronic
1066999463 10:42593862-42593884 CACTTTCAATGTAATCAATGTGG - Exonic
1068067764 10:52153340-52153362 CAATGACAATGTGATTAATTGGG - Intronic
1068753186 10:60619926-60619948 CAGTCTCAAAGTAATTACTGTGG - Intronic
1070567980 10:77618370-77618392 CAGTGGCGATGGAATCATTGAGG - Intronic
1072321493 10:94254487-94254509 TAATGGCAAGTTAATTAATGGGG - Intronic
1074285396 10:112093012-112093034 CTGTAGCAAGGTAATTAATCAGG + Intergenic
1075191150 10:120309963-120309985 CAGTGGAAATGAAATTGATTGGG - Intergenic
1076184953 10:128439551-128439573 CATTGGAAATGTAAATCATGTGG - Intergenic
1079582320 11:22080913-22080935 CAGTGGCAATGTAGTTAAAGAGG - Intergenic
1082940916 11:58704182-58704204 CAGTGGCAAATAAATTCATGAGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084710099 11:70838890-70838912 CAGGGGAAATCTAATTAATGTGG + Intronic
1085317030 11:75551615-75551637 GACTGGCAATGTAATTTGTGAGG + Intergenic
1092040082 12:5376459-5376481 CAGTTGGAATATAATCAATGTGG + Intergenic
1093542695 12:20305740-20305762 CGGTGGCAACGTAAGTTATGAGG - Intergenic
1094642079 12:32285626-32285648 CAGGTGCAATGCAAATAATGAGG + Intronic
1094759247 12:33511161-33511183 AAGTGGATATGTAATTAAGGTGG + Intergenic
1095432480 12:42149051-42149073 CGGTGGAAAACTAATTAATGAGG + Intergenic
1096253366 12:50047835-50047857 CAGTGGCAATGGAAATAAAAAGG - Intergenic
1096549442 12:52362582-52362604 CCGTGGCCAGGTAGTTAATGGGG + Intronic
1098466226 12:70789469-70789491 CAGAGGCAAAGTAACTAATCTGG + Intronic
1099333678 12:81326099-81326121 CAGTGGCAACATAATAAATGTGG + Intronic
1101396752 12:104355614-104355636 CAGTGGAATTTTAATTAAGGTGG + Intergenic
1103777810 12:123379511-123379533 CAGAGGCAGTGTTATTACTGAGG + Intergenic
1104332582 12:127861085-127861107 CAATGGAAATATAATTAATATGG - Intergenic
1107650842 13:42543067-42543089 CAGTAGCAATCTATTGAATGAGG - Intergenic
1110273489 13:73617077-73617099 CATTGGCAATGTAACTGATGTGG - Intergenic
1111433260 13:88172589-88172611 CAGTGGGAATGCCATTACTGTGG + Intergenic
1111509715 13:89244886-89244908 TAGTGGAAATGTAATTTAGGGGG - Intergenic
1114373496 14:22116431-22116453 CAGTGACACTGTCTTTAATGTGG + Intergenic
1116445301 14:45002320-45002342 CAAAGGCAATGTAATTATTCAGG - Intronic
1118949572 14:70422301-70422323 CAGTGTAGATGTAATGAATGAGG - Intergenic
1120149884 14:81021324-81021346 CAGTGGAATAGTAATTAATTAGG - Intronic
1120524731 14:85564481-85564503 CAGTGGAAATGTAATGACTTAGG - Intronic
1120684282 14:87519736-87519758 CATTGGAAATGTAATTAACTTGG - Intergenic
1121531764 14:94659269-94659291 AAGAGGTAATGTAATTAATATGG - Intergenic
1126282072 15:46965124-46965146 CAGTGACAATTTAATTGATTTGG - Intergenic
1127337165 15:57999586-57999608 CAGTGGGAATGTAAACAAAGTGG - Intronic
1128619819 15:69139256-69139278 CAGTGGCCACATAATTAATATGG + Intergenic
1133508500 16:6435048-6435070 CAGTATTAATGGAATTAATGAGG - Intronic
1135161874 16:20103698-20103720 CTCTGCCAATGGAATTAATGAGG + Intergenic
1135176846 16:20237602-20237624 CAGTGGCCCTTTAATCAATGTGG + Intergenic
1138182174 16:54948821-54948843 CAGAGGCGATGTAATTTACGGGG + Intergenic
1139760594 16:69181671-69181693 CAGTGGAAATCTACTTACTGTGG - Intronic
1140148941 16:72341860-72341882 CAGTGGCAATGTAAATAGGGAGG - Intergenic
1141928158 16:87182685-87182707 CAGTGGGAGTCTAATTAAAGGGG - Intronic
1148535305 17:48433633-48433655 CAGAGGCCATGAAATTAATCTGG + Intergenic
1148790783 17:50171508-50171530 AAGTGCCACTGCAATTAATGAGG - Intronic
1149119331 17:53142618-53142640 TAGTAGAAATGTAGTTAATGAGG + Intergenic
1149223623 17:54443073-54443095 CAGTGGCAATTAAATTAATATGG + Intergenic
1149717719 17:58809685-58809707 AAGTGGCAATGAAAAAAATGAGG - Intronic
1151239850 17:72749323-72749345 CAGTGGCCAGGTGATTGATGAGG - Intronic
1153891815 18:9523891-9523913 CAGACGCAATGGAATGAATGAGG - Intronic
1154434733 18:14334914-14334936 CAGTGGGAATCTAGTTAGTGAGG + Intergenic
1155542379 18:26881930-26881952 CAGAGGCAATGTAGTTCAGGTGG - Intergenic
1155781598 18:29844555-29844577 CAGTGGGAAGGTAACTAATTAGG + Intergenic
1156727565 18:40147938-40147960 AGGTGGTAATGTAAATAATGGGG + Intergenic
1156974069 18:43195457-43195479 AAGTTACAATGTAATTGATGAGG - Intergenic
1157366959 18:47074015-47074037 CAGTGGCAATCTACCCAATGAGG - Intronic
1159230461 18:65601024-65601046 CTGTGGCAAGACAATTAATGAGG + Intergenic
1159338026 18:67096178-67096200 CAGTGGGAATGTTTGTAATGAGG - Intergenic
1160201956 18:76803009-76803031 CAGTGGCAATGTAATTAATGAGG + Intronic
928273716 2:29880139-29880161 AAGTGGCCTTGTCATTAATGAGG - Intronic
929214782 2:39400554-39400576 CACTGGAAATGTAAATAATAAGG - Intronic
930327273 2:49935721-49935743 CTGAGCAAATGTAATTAATGAGG + Intronic
930878923 2:56249953-56249975 CAGAGGCAATGCAAAGAATGAGG - Intronic
931766684 2:65463146-65463168 CAGAGGCAATTAAGTTAATGTGG + Intergenic
935188134 2:100752871-100752893 CAAAGGCAATGTGATAAATGGGG + Intergenic
937891272 2:126940717-126940739 CAGTGGGAAAGTAATGAAGGCGG - Intergenic
939034015 2:137109703-137109725 CGGTGGCAATGTGAGTGATGGGG + Intronic
939832023 2:147083735-147083757 AAGTTCCAATGAAATTAATGTGG - Intergenic
940218353 2:151324248-151324270 TAATGGCAATGTATTTAAAGTGG - Intergenic
942430610 2:175907260-175907282 CAGTGGTAATGCAAGTGATGGGG + Intergenic
942946061 2:181675340-181675362 CATTGGCAATGTTATTAGTATGG + Intronic
943619240 2:190129579-190129601 GAGGGGGAAAGTAATTAATGTGG + Intronic
944012381 2:194988078-194988100 CATTGACAGTGTCATTAATGTGG + Intergenic
944518647 2:200540517-200540539 CAGAGGCCATGAAAGTAATGAGG - Intronic
945905842 2:215592436-215592458 GAGTGGCAAGATAATTCATGGGG - Intergenic
1169130918 20:3166060-3166082 CAGTGCCAATGCGGTTAATGTGG + Exonic
1169897648 20:10521624-10521646 GAGTGGCAATATTATTCATGAGG + Intronic
1172369442 20:34376828-34376850 CAGTGGGAATGAAAATAAAGGGG + Intronic
1172655564 20:36535044-36535066 CAGTGCCAAGGTATTCAATGGGG + Intergenic
1174672065 20:52317862-52317884 CAGTAGCCATGTAATAAATTGGG - Intergenic
1175599733 20:60263528-60263550 CAGTGGCCAGGTAATTCCTGGGG - Intergenic
1175642865 20:60645905-60645927 CAATGGCAGTCTAATTTATGTGG + Intergenic
1176853734 21:13945531-13945553 CATTTGCAATGTAAAAAATGGGG - Intergenic
1182999312 22:34841840-34841862 CAGTGGAATTGTAATTGGTGCGG + Intergenic
951333742 3:21396341-21396363 CAGTGTCAATGTAGTCACTGTGG + Intergenic
956070062 3:65439574-65439596 CAGTTGCAATGCAAATACTGCGG + Intronic
956902151 3:73728044-73728066 CACTGGCAATGTCAGTTATGGGG - Intergenic
959028621 3:101271660-101271682 CAGGGGCAATGTAATTCAATGGG - Intronic
959180904 3:102979434-102979456 CTGTTGCAAAGTAATTTATGTGG + Intergenic
962285453 3:134082297-134082319 CAGTGGTAATGTGAGTGATGGGG - Intronic
963652881 3:148006593-148006615 CAGTGGCCATGTATGTCATGAGG + Intergenic
966403040 3:179565978-179566000 CAGTGGCAATGGTATTAAAAAGG + Intronic
967656588 3:192057426-192057448 AAATAGCAATGTAATTAAAGTGG - Intergenic
971871840 4:32251018-32251040 CAGTGGCAAGGTAATTAGCTGGG - Intergenic
973366714 4:49214349-49214371 CAGTGGGAATCTAGTTAGTGAGG - Intergenic
976443884 4:85108389-85108411 CAGAGGTAATGTAGTGAATGTGG - Intergenic
980191696 4:129532880-129532902 TAGTGGCAATGCACTCAATGTGG + Intergenic
980667870 4:135962045-135962067 CAATTGCAATGAGATTAATGAGG + Intergenic
980908603 4:138973608-138973630 CAGGAGCACTGTAATTAATGGGG - Intergenic
981941865 4:150289899-150289921 CACTTGCAATGAAATTACTGAGG + Intronic
986516255 5:8566958-8566980 CAGAGGCTGGGTAATTAATGGGG - Intergenic
988005204 5:25401797-25401819 CAGTGGAAATGTAAATAATTAGG - Intergenic
990545785 5:56819528-56819550 GGGTGGCAAGGTAGTTAATGGGG + Intronic
994979012 5:106848319-106848341 AAGTGGCAAGGTAATCATTGAGG - Intergenic
995963918 5:117880995-117881017 CATTTGCAATGTAAACAATGGGG + Intergenic
999865052 5:155692034-155692056 CATTGGAACTTTAATTAATGTGG - Intergenic
1000272250 5:159697165-159697187 CAGAGGCAATGTTTTTACTGGGG - Intergenic
1000532093 5:162435857-162435879 CAGTGACTATGAAAGTAATGGGG - Intergenic
1004219213 6:13731106-13731128 CAGGGGAACTGTATTTAATGAGG - Intergenic
1004680010 6:17884351-17884373 CAGTAGCTATGCTATTAATGGGG - Intronic
1004981877 6:21033286-21033308 CACTGGCAATGGAAATAAAGAGG + Intronic
1006539748 6:34730031-34730053 CAATGGCACTGTAATTTAAGTGG - Intergenic
1007132495 6:39488871-39488893 CAGAGTTAATGAAATTAATGAGG - Intronic
1008216126 6:48792030-48792052 AAGTGTGAATGTAATTAAAGTGG - Intergenic
1009721617 6:67478298-67478320 CAGAGGAAATGTAATTTAGGGGG + Intergenic
1010335402 6:74676607-74676629 CAGTGGCAATGTGAACAATTTGG + Intergenic
1010641014 6:78327305-78327327 TGGTGGCAATGTATTTAAGGAGG - Intergenic
1010812977 6:80321438-80321460 TTGTGGTAATGTAATTCATGTGG + Intronic
1014985079 6:127996402-127996424 CTGAGTCAATTTAATTAATGAGG + Intronic
1018752091 6:166815699-166815721 CAGTGGCAATGGAATTAAAGAGG + Intronic
1020498152 7:8882696-8882718 CAGTGGCCATAAAATTAATATGG + Intergenic
1022128098 7:27377332-27377354 CAGTGGACATGTATTAAATGAGG + Intergenic
1026668386 7:72364316-72364338 CAGAGTCAAAATAATTAATGGGG + Intronic
1032654062 7:133908424-133908446 AAGAGGCAATGGAATTAAAGAGG + Intronic
1032981743 7:137292098-137292120 CAGTGGCAATGAACATAAAGTGG - Intronic
1037023871 8:14008055-14008077 CAGGGACACTGTTATTAATGTGG - Intergenic
1039253833 8:35696425-35696447 CATTTGCAGTGTAATTAATCAGG + Intronic
1041216116 8:55602173-55602195 TAGTGCCAAAGTAATAAATGTGG - Intergenic
1042457088 8:69018445-69018467 CACTGCCAATGTAATGAGTGTGG + Intergenic
1042502274 8:69522494-69522516 CAGTGGAAATATCATTAATTAGG + Intronic
1043665544 8:82807017-82807039 TAGTGGCAAAGAAATTAAGGTGG - Intergenic
1046358216 8:113116057-113116079 CAGTGAGAATGAAATTTATGTGG + Intronic
1048387701 8:133927977-133927999 CAGTGGTAATGCAAGTGATGGGG + Intergenic
1048778931 8:137979892-137979914 AAGTTGTAATGTATTTAATGTGG + Intergenic
1050030983 9:1385199-1385221 AAGTGAAAATGTAATGAATGAGG - Intergenic
1052106298 9:24521328-24521350 AAGTGGCAGTGTAATAAAAGAGG + Intergenic
1055879485 9:80982828-80982850 TAGTGGCATTATAATTAAGGTGG + Intergenic
1057461097 9:95262918-95262940 CAGAGGCAAATTAATTCATGAGG + Intronic
1057967204 9:99515836-99515858 CTGTGGCCATGGAATTAATAAGG + Intergenic
1185818262 X:3176937-3176959 CCATGGCAAAGTAATTATTGAGG + Intergenic
1186120327 X:6354200-6354222 CAGTTGCCAAGTAATTAAAGGGG - Intergenic
1196384169 X:115130154-115130176 AAGTGGCAATGAAAATGATGAGG - Exonic
1197654276 X:129099391-129099413 AAGTGTCAAAGTAATGAATGGGG + Intergenic
1197875510 X:131100488-131100510 CAGTTGCAAGGAAATTAATTAGG - Intergenic
1199298028 X:146181351-146181373 CAGTGCAAATGTAATTGAGGAGG + Intergenic