ID: 1160202721

View in Genome Browser
Species Human (GRCh38)
Location 18:76808779-76808801
Sequence CTCTCTCTGCAGGGGTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160202721_1160202728 7 Left 1160202721 18:76808779-76808801 CCAACGCACCCCTGCAGAGAGAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1160202728 18:76808809-76808831 TCCCCCCACAGGCATGTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 144
1160202721_1160202735 30 Left 1160202721 18:76808779-76808801 CCAACGCACCCCTGCAGAGAGAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1160202735 18:76808832-76808854 AGGAGCGTGCACAGTCCTAACGG 0: 1
1: 0
2: 0
3: 6
4: 73
1160202721_1160202732 10 Left 1160202721 18:76808779-76808801 CCAACGCACCCCTGCAGAGAGAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1160202732 18:76808812-76808834 CCCCACAGGCATGTTTGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 169
1160202721_1160202726 -4 Left 1160202721 18:76808779-76808801 CCAACGCACCCCTGCAGAGAGAG 0: 1
1: 0
2: 3
3: 13
4: 179
Right 1160202726 18:76808798-76808820 AGAGCCAAGGATCCCCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160202721 Original CRISPR CTCTCTCTGCAGGGGTGCGT TGG (reversed) Intronic
900921036 1:5670765-5670787 CTTTCTCTGCAGAGCTGCCTAGG - Intergenic
900991964 1:6102141-6102163 CTTCCTCTCCAGGGGTGCTTGGG + Exonic
902664947 1:17930905-17930927 CTCTATCTGCAGGGCCGGGTGGG - Intergenic
902684925 1:18070148-18070170 CTCCCTCTGCAGGGAGGGGTTGG + Intergenic
903218404 1:21855436-21855458 CTCTGTCTGCAGGGGGCGGTGGG - Exonic
907489317 1:54799088-54799110 CTCTCTCTGGAGGTTTGTGTAGG + Intronic
907587773 1:55636623-55636645 CTCACACTGCAGGGCTGCTTAGG + Intergenic
909399043 1:75205560-75205582 CTCTCTCTGCAGGGCTTAGGAGG - Exonic
918710545 1:187722624-187722646 CTCTCTCTGAAGGGGAGAATAGG - Intergenic
921959511 1:221020110-221020132 TGCTCTCTGCAGTGGTGCGTGGG - Intergenic
922218627 1:223540845-223540867 CCCTCCCTGCAGTGGTGCGATGG + Intronic
924441339 1:244087861-244087883 CTCTGGCTGCAGGAGTGCGTGGG + Intergenic
1066065726 10:31759785-31759807 CGCACTCAGCAGGGGTGCGGGGG - Intergenic
1067713983 10:48672404-48672426 CTCTCTCCGCAGGGCTGGGGTGG + Intergenic
1070671992 10:78384339-78384361 CTCTCTCCCCAGGGGTTGGTGGG + Intergenic
1071347222 10:84704252-84704274 ATCTCTCTGCATGGCTGCCTTGG - Intergenic
1071559275 10:86632547-86632569 CTGGCCCTGCAGGGGTGTGTGGG - Intergenic
1072255173 10:93614198-93614220 CTTTCTGTGCAGGGGTGTATAGG + Intronic
1075652201 10:124134883-124134905 CTCTCTCTGAAGGGGTCCTCTGG - Intergenic
1077077415 11:707812-707834 CTGAGTCTGCAAGGGTGCGTTGG + Intronic
1078540015 11:12205864-12205886 CTTTCTCTGTAGGGGTAGGTGGG + Intronic
1083180620 11:60982483-60982505 CTCTTTCAGGAGGGGTGCCTGGG + Intronic
1083842781 11:65314516-65314538 CCTTCCCTGCAGGGCTGCGTCGG - Intergenic
1083861188 11:65421207-65421229 CTGTATCTCCAGGGGTGGGTTGG - Intergenic
1083881970 11:65553348-65553370 CTCCCACTGCAGGGATGGGTGGG + Intronic
1084919875 11:72460327-72460349 CTCTCTCAGCAAGGCTGAGTGGG - Intergenic
1090412243 11:126517401-126517423 CTCTCTCTGCACATGTGCATGGG + Intronic
1090427231 11:126616467-126616489 CTCTCTCTGGAGGGGTTAGGTGG + Intronic
1090566895 11:128004471-128004493 CTCTCTCAGCAGGAGTTCATGGG - Intergenic
1090957369 11:131525247-131525269 CTCTCTCTGAAGTGGGACGTGGG + Intronic
1092280056 12:7091816-7091838 TGTTCTCAGCAGGGGTGCGTGGG + Intronic
1095496672 12:42791708-42791730 CTCTCACTGCAGGGTTGTTTTGG + Intergenic
1096891396 12:54775289-54775311 CCCTCTGTGCATGGGTGTGTAGG + Intergenic
1099992337 12:89737353-89737375 CTCTCTCTGCTGAGCTGCCTGGG - Intergenic
1101826232 12:108222216-108222238 CTCTCTCTGTAGCGGTGTCTGGG - Intronic
1102470848 12:113159068-113159090 CTCGGCCTGCAGGGGTGCCTGGG + Exonic
1103593022 12:122005620-122005642 CTCTTTCTGCAGGTGTTTGTGGG + Intergenic
1104769916 12:131354945-131354967 CTCTCTCTGCAGTGCAGCCTGGG - Intergenic
1104979500 12:132567469-132567491 CTCTCTCTCCAGGCATCCGTGGG + Exonic
1104987290 12:132604116-132604138 CTCTCCCAGCAGGGGTGCCTGGG + Intronic
1110713170 13:78672270-78672292 CTCTCTCTGTTGGAGTGGGTTGG + Intergenic
1112750260 13:102576140-102576162 CTCTGTCTACAGGGGAGCCTGGG - Intergenic
1113764293 13:112871125-112871147 CCCCCTCTGCATGGGTGCCTGGG + Intronic
1114690224 14:24574204-24574226 CCCTCTCTCCCGGGGTGTGTTGG + Intronic
1115965907 14:38887938-38887960 CTCTCTCAGCAGGGGTTCCAGGG - Intergenic
1116835814 14:49768253-49768275 CTCTGTCTGCAGGCGTGCCCCGG + Exonic
1118488075 14:66233015-66233037 CTGCCTCTGCAGGGGTGGGGTGG + Intergenic
1118964209 14:70564237-70564259 CTTTCTCTTCAGGAGTGAGTGGG + Intergenic
1120729347 14:87984523-87984545 TTCTCTCTGCAGGGTTGCCATGG - Exonic
1121317146 14:92969072-92969094 CTCTCACTTCATGGGTGTGTCGG - Intronic
1122665491 14:103326810-103326832 CTCCCCCTCCAGGTGTGCGTGGG - Intergenic
1123141239 14:106081157-106081179 ATCTCCCTGCAGGGGTGCATAGG - Intergenic
1123166404 14:106329373-106329395 CCCTCCCTGCAGGGGTGAATAGG - Intergenic
1123180297 14:106463196-106463218 ATCTCCCTGCAGGGGCGCGCAGG - Intergenic
1123214092 14:106790633-106790655 ACCTCCCTGCAGGGGCGCGTGGG - Intergenic
1202946602 14_KI270726v1_random:33457-33479 ATCTCCCTGCAGGGGCGCGCAGG + Intergenic
1123411647 15:20065967-20065989 ACCTCACTGCAGGGGTGCCTGGG + Intergenic
1123520993 15:21073086-21073108 ACCTCACTGCAGGGGTGCCTGGG + Intergenic
1125721595 15:41847637-41847659 CTCTCTCCACAGGGGTCCGGCGG + Exonic
1127798085 15:62455208-62455230 CTCTTCCTGCAGGAGTGTGTAGG + Intronic
1128063585 15:64750371-64750393 CTCTCTCCGCAGGGGTATGAAGG - Exonic
1128554779 15:68623870-68623892 TTCTCTCTGCAGCTGAGCGTGGG + Intronic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1132739033 16:1401782-1401804 CTCTCTGTGCAGTGGTGGGAGGG - Intronic
1133183940 16:4081714-4081736 CTGTGTCTGCAGGGGCGTGTGGG + Intronic
1133183957 16:4081778-4081800 CTGTGTCTGCAGGGGCGTGTGGG + Intronic
1133750784 16:8723672-8723694 CTCTCACTGCAGGGTTGCGCTGG - Intronic
1135109059 16:19676363-19676385 CTCTGTCTGCAGGGGAGAGAGGG - Intronic
1137554323 16:49461142-49461164 CTCCCTGTGCAGGGGTGAGAAGG - Intergenic
1138098866 16:54235541-54235563 CTCTTTCTGCAGGGCTGCAGGGG - Intergenic
1138534075 16:57650567-57650589 CTCTGGCTGCAGAGGTGAGTGGG - Intronic
1139605308 16:68014017-68014039 CTCTATCTGCAGTGGTGGGCAGG + Intronic
1141439804 16:84022741-84022763 CACCCTCTGCAGGGGTGCCTGGG + Intronic
1141572288 16:84941311-84941333 CCCTCTCTGCAGGGCCGCATGGG + Intergenic
1141621396 16:85238391-85238413 CTACCGCTGCAGGGGTGCGGGGG - Intergenic
1142485760 17:246892-246914 CGCTCTGTGCAGGAGTGCGGCGG - Intronic
1147343505 17:39770603-39770625 CTCTGTCTGCAGGGTTGAGGGGG + Intronic
1148070965 17:44908258-44908280 CTCTCTCTGCTCGGTTGCATAGG - Intronic
1150248539 17:63693472-63693494 CTCTTTCTGCAGTGGTGGGCAGG + Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151728596 17:75898193-75898215 CTCTCTCTCCAGGGGCCGGTGGG + Intergenic
1153375915 18:4378922-4378944 CTCTCTCTGGAGGGGAGTGGTGG - Intronic
1153962388 18:10150489-10150511 CTCTCTCTGCATGGAAGGGTTGG + Intergenic
1154044657 18:10893516-10893538 GTCTCTCTGCATGGGTTCCTTGG + Intronic
1154068209 18:11129147-11129169 CCCTCTCAGCTGGGATGCGTAGG - Intronic
1154138281 18:11800305-11800327 CCCTCACTGCAGGGGTGGATTGG - Intronic
1155502798 18:26503960-26503982 CTCTTTCTGCAGGGTTGCTGTGG + Intronic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1159904378 18:74076896-74076918 ATCTCTCAGCAGGGGAGCTTGGG - Intronic
1160202721 18:76808779-76808801 CTCTCTCTGCAGGGGTGCGTTGG - Intronic
1160734941 19:658196-658218 ATCACGCTGCAGGGGTGCATGGG - Intronic
1160903293 19:1439946-1439968 CTCTGTCCGCCGGAGTGCGTAGG + Intronic
1161586998 19:5111023-5111045 CTCGCTTTGCTGGGGTGGGTGGG + Intronic
1161737934 19:6002926-6002948 CGCTCCTTGCAGGGGTGTGTGGG + Intronic
1161772626 19:6239351-6239373 CTCCCTCTGCAGGGGTGCCTCGG - Intronic
1166668458 19:44695658-44695680 CTCTCTGGGCAGGGGTGGGGAGG - Intergenic
1167262619 19:48467596-48467618 CCCTCTTTACAGGGGTGCCTGGG + Intronic
927095149 2:19742645-19742667 CTCTCCCTGGAGGGGTAGGTGGG - Intergenic
928288708 2:30018132-30018154 CTCTGCCTGCAGGGCTGCTTGGG - Intergenic
932563201 2:72889886-72889908 CTCTCTCAGCAGGGATGCACAGG + Intronic
934505616 2:94890436-94890458 CTCTCCCTGCAGGGGAGTATCGG - Intergenic
934976768 2:98808444-98808466 CTCTCTCTTCAGGGTTTCTTTGG - Intronic
937206714 2:120241249-120241271 CTCTCCCTGCAGGGGACCTTGGG - Intronic
938161659 2:128989800-128989822 CTCCCTCTGCACTGGTGCCTGGG - Intergenic
939580142 2:143937482-143937504 CTCTCTCGGCAGGCGAGCGCCGG + Intergenic
948027798 2:234791650-234791672 CTTTCTCTGGAGGGCTGCATTGG + Intergenic
948762720 2:240202765-240202787 CTCCCTCTGCAAGGGTGAGGTGG - Intergenic
1169193050 20:3669793-3669815 CTCCCTCTTCAGGGGAGCCTTGG + Intronic
1169411285 20:5372505-5372527 CTCTCCCTGCAGGGGTGGCCAGG - Intergenic
1169486206 20:6035513-6035535 CTCTCTCTTCATGGGTTCCTAGG - Intronic
1171773647 20:29346421-29346443 CTTTCTCTGCAGAGTTGCCTAGG + Intergenic
1171815671 20:29783971-29783993 CTTTCTCTGCAGAGTTGCCTAGG + Intergenic
1171902702 20:30872064-30872086 CTTTCTCTGCAGAGTTGCCTAGG - Intergenic
1173560875 20:44004489-44004511 CTCCCTCTGCAGGGCTGCAGTGG - Intronic
1174405278 20:50298910-50298932 CTCTGCCTGCCGGGGTGCGTGGG - Intergenic
1175205171 20:57305650-57305672 CTCTCTCTGCTGGGGTTATTAGG + Intergenic
1175276803 20:57776541-57776563 CTTTCTCTGCCGGGCTGCTTTGG + Intergenic
1175707882 20:61194605-61194627 GTCTCCCTGCAGGCGTGCCTTGG + Intergenic
1176523592 21:7847411-7847433 CTCTCACTGAAGGGATGGGTCGG + Intergenic
1178657612 21:34477423-34477445 CTCTCACTGAAGGGATGGGTCGG + Intergenic
1179480921 21:41678190-41678212 CTCTGTCTGCAGGGGACTGTGGG + Intergenic
1180319117 22:11304538-11304560 CTTTCTCTGCAGAGTTGCCTAGG + Intergenic
1180336092 22:11578035-11578057 CTTTCTCTGCAGAGTTGCCTAGG - Intergenic
1182119722 22:27778997-27779019 CCATCTCTGCAGGGGTGGGTAGG - Intronic
1185210989 22:49570373-49570395 CTCTCTCTGCAAGGGTACGTGGG + Intronic
949519219 3:4834472-4834494 ATCTCTCTGCAGCTGTGCTTTGG + Intronic
949904185 3:8844691-8844713 CCTTATCTGCAGGGTTGCGTGGG - Intronic
950406614 3:12808997-12809019 TTCTCTCTGCAGTGGAGAGTAGG + Intronic
950647374 3:14385222-14385244 CTCTCTGTGCTGGGGTCCCTTGG + Intergenic
951186499 3:19719926-19719948 CTCTCTGTGCCGTGGTGCCTAGG + Intergenic
951604843 3:24421622-24421644 CTCTCTGGGCATGGGTGCCTTGG - Intronic
952276583 3:31883187-31883209 CTGTGTCTGCAGGTGTGTGTAGG - Intronic
953576639 3:44117932-44117954 CTAACTCAGCAGGGGTGGGTGGG - Intergenic
954930372 3:54276098-54276120 CCCTCCCTGCAGGGATGGGTTGG + Intronic
955346890 3:58168066-58168088 CTCTCCCTCCAGGGGTGTGGGGG - Intronic
955879384 3:63527525-63527547 CTCTGTCTGCAGAGGTGCTCAGG - Intronic
957823413 3:85408673-85408695 CTCTCTCTGCAGCGGGGGTTAGG + Intronic
960928496 3:122820683-122820705 CAATGCCTGCAGGGGTGCGTGGG - Intronic
961593924 3:128001676-128001698 CTCTCTCTGCAGGTGAGGGATGG - Intergenic
967144134 3:186591693-186591715 CTTTCTCTGCTGGGGTGCCTGGG + Intronic
967829824 3:193909382-193909404 CTGTCTTTGCAGGGGTTCCTGGG + Intergenic
967972607 3:195010695-195010717 TTCTCTATGCAGGGGTGGCTGGG - Intergenic
970428005 4:15963224-15963246 CTTTCTCTGCAAGGGTGGGGAGG + Exonic
972841797 4:42939646-42939668 CTTTCTCAGCATGGGTGCTTAGG - Intronic
979708580 4:123750363-123750385 CTCTCTCTGAAGGGGCCCTTCGG - Intergenic
981996051 4:150976891-150976913 CTCTCTCTGTAGGTGGACGTTGG - Intronic
983999126 4:174218630-174218652 CTCTCCCTCCAGGTGTGTGTGGG - Intergenic
984634614 4:182097450-182097472 CTCTCTCAGAAGGGGTCGGTAGG - Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
987076049 5:14382610-14382632 CCCTCCCTGCAGGGGAGGGTGGG - Intronic
989581600 5:43038584-43038606 CTCGCTCTGCTGGAGGGCGTTGG + Intergenic
995008471 5:107230361-107230383 CTATGTTTGCAGGGGTGCATAGG + Intergenic
996412001 5:123168767-123168789 CTCTGTCTGCAGGGCTCTGTCGG - Intronic
999414905 5:151386580-151386602 CTCTCACTGCATGGGTGTCTTGG + Intergenic
1003035644 6:2638510-2638532 CTCTCTCTGCATGGTTGGGCAGG + Intergenic
1003382231 6:5635672-5635694 CTCTGTGTGCAGGGTGGCGTTGG + Intronic
1007967044 6:46013209-46013231 CTCTTTCTGCAGGGCAGGGTGGG - Intronic
1008096269 6:47342666-47342688 CTCTGTCTTCAGGGGTGTGAAGG + Intergenic
1009860050 6:69317180-69317202 CTCTCTCTGCATGGGTGAGTGGG + Intronic
1012546667 6:100427186-100427208 CTCTCTCTGCTGGGCTCCATAGG - Intronic
1016383999 6:143513523-143513545 ATCTCTCTGCAGAGATGGGTTGG - Intergenic
1018623195 6:165751374-165751396 CTCTCTCTGTAGGTGTGAGCTGG + Intronic
1019163287 6:170083067-170083089 CTCTCTGGGCAGTGGTGCGGAGG - Intergenic
1021253127 7:18356583-18356605 CTCTCTCTACAGGGGAACATAGG + Intronic
1024229563 7:47353896-47353918 CCCTTTCTGCAGGTGTGAGTGGG - Intronic
1024334275 7:48189325-48189347 ATTTCTCTGCAGGGGTGCAAAGG - Intronic
1029711896 7:102304312-102304334 CTCTTCCTGCAGGGGTGAGGAGG - Intronic
1035320880 7:158028584-158028606 CTGTCTCCGCTGGGCTGCGTCGG - Intronic
1035337219 7:158137680-158137702 CTCTCTCTGCACGGGTGCAGAGG - Intronic
1035368106 7:158361574-158361596 CTCTCTCTGGAGGGCTGTTTGGG - Intronic
1048976055 8:139673799-139673821 TCCTCTCTGCAGGGGTGGGGAGG - Intronic
1049399608 8:142419029-142419051 CTCTCCCTGCAGGGTTGGGGTGG + Intergenic
1049735465 8:144202610-144202632 CTCTCTGTGGAGGGGTGGGGAGG + Intronic
1050032954 9:1405582-1405604 CTCTCTCTGCATGTGTGTTTTGG + Intergenic
1050652012 9:7786345-7786367 CTATCTCTGCAGGGGGTCCTCGG + Intergenic
1051140321 9:13971729-13971751 CCCTCTCTTCATGGGTACGTGGG - Intergenic
1057266285 9:93620098-93620120 CTCTTTCTGCAGATGTGGGTGGG + Intronic
1057520912 9:95759594-95759616 CTCTCTATCCATGGGTGCTTGGG - Intergenic
1057846731 9:98531617-98531639 CCCACTCTGCAGGGGTGGGTAGG + Intronic
1059434921 9:114270458-114270480 CTCCCTCTGCAGGGTGACGTGGG - Intronic
1059446744 9:114342735-114342757 CTGACTCTGCCGGGGTGGGTGGG - Intronic
1061550826 9:131333850-131333872 CTGCCTCTGCAGGGCTGTGTGGG + Intergenic
1062138941 9:134944833-134944855 CTCTTTCTGCAGGGGTTTGCTGG + Intergenic
1062518669 9:136948254-136948276 CTCTGACTGCAGGGCTGGGTGGG + Intronic
1203367345 Un_KI270442v1:270287-270309 CTTTCTCTGCAGAGTTGCCTAGG + Intergenic
1187161197 X:16766890-16766912 GTATCTCTGCAGGGGAGCCTGGG - Intergenic
1187395877 X:18918991-18919013 CTTACTCTTCAGGGGTGAGTGGG - Intronic
1190708561 X:53049457-53049479 CTCTCTCAGCAGGGATGTCTTGG - Exonic
1193094153 X:77528214-77528236 CTCTGTCTGCAGGAGTGGGTCGG - Intronic
1197805982 X:130399069-130399091 CTCTCTCAGCAGAGGTGCCTAGG + Intergenic
1199736243 X:150689282-150689304 CTCTCCCTGCAGGGGAGAATGGG + Intergenic
1201071348 Y:10149945-10149967 CTTTCTCTGCAGAGTTGCCTAGG - Intergenic
1201798205 Y:17924713-17924735 CTCTCTCAGCTGGGATGAGTAGG - Intergenic
1201803348 Y:17981244-17981266 CTCTCTCAGCTGGGATGAGTAGG + Intergenic
1202359530 Y:24093404-24093426 CTCTCTCAGCTGGGATGAGTAGG - Intergenic
1202511248 Y:25576710-25576732 CTCTCTCAGCTGGGATGAGTAGG + Intergenic