ID: 1160202759

View in Genome Browser
Species Human (GRCh38)
Location 18:76808952-76808974
Sequence TAGCAGCCCCAGCATTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160202759 Original CRISPR TAGCAGCCCCAGCATTACCA AGG (reversed) Intronic
900708936 1:4098906-4098928 TAGCCGCCCCAGCTTTCTCATGG + Intergenic
902267106 1:15275405-15275427 CAGCAGCCCGAGCGTTTCCAGGG + Intronic
902563240 1:17291820-17291842 TAGCATTATCAGCATTACCAGGG + Intergenic
904529754 1:31160587-31160609 TAACAGCTCCTGGATTACCATGG - Intergenic
904677456 1:32207074-32207096 TTGCAGCCACAGCAATTCCATGG - Exonic
905965711 1:42093515-42093537 TGGCAGCCCAAGCAGTACCTGGG + Intergenic
906165065 1:43679970-43679992 TAGCAGCCCCACCAGTAAAACGG - Intronic
906275606 1:44513019-44513041 CAGCATCCTCAGCATTCCCAAGG + Intronic
906722831 1:48021770-48021792 TAGCTGCCTCAGAATTACCTGGG - Intergenic
907525110 1:55049555-55049577 TAGCAGCCCCTGCCTCACCCGGG + Intronic
907788045 1:57633389-57633411 CAGCAGCATCAGCATCACCAGGG - Intronic
908185489 1:61648917-61648939 TAGAAGCCCCAGAAGTACCATGG - Intergenic
908985075 1:70007895-70007917 TAGCAGTGTCAGCATTCCCATGG + Intronic
909068135 1:70961050-70961072 CAGCAGCATCAGCATTACCTGGG - Intronic
909167423 1:72246977-72246999 TAGCAGCCCGAGCTGTACCTGGG + Intronic
909914414 1:81299713-81299735 TAGCAGCCAAAGCATTCCAAGGG + Intergenic
909920261 1:81373054-81373076 TAGCAGCATTAGCATGACCATGG - Intronic
910846227 1:91606850-91606872 TTGCAGTCCAAGGATTACCAGGG - Intergenic
913290408 1:117266698-117266720 TAGGAGCATCAGCATCACCAGGG + Intergenic
915758202 1:158283979-158284001 TAGCATTCTCAGCATTCCCACGG + Intergenic
916274900 1:162983170-162983192 CAGCAGCATCAGCATTACCTAGG + Intergenic
917629271 1:176876924-176876946 CAGCAGGACCAGCATTACCTGGG + Intronic
918552997 1:185765741-185765763 TAGCAGCATCAGCATTAACTGGG + Intronic
919085962 1:192920180-192920202 TAGCAGCACCAGCAGCGCCAAGG - Intergenic
919823350 1:201486581-201486603 TAGCAGCCCCTGCTTTACAGAGG - Intronic
920763630 1:208810107-208810129 CAGCAGCATCAGCATTACCTGGG - Intergenic
923651114 1:235874953-235874975 CAGCAGCATCAGCATTACCTGGG + Intronic
1065893629 10:30142091-30142113 CAGCAGCCTCAGCCTTACCTGGG + Intergenic
1066096892 10:32080827-32080849 TAGCAGGGTCAGCATTCCCATGG + Intergenic
1068029377 10:51688271-51688293 CAGCAGCACCAGCATCACCTGGG - Intronic
1069331607 10:67300018-67300040 CAGCAGCATCAGCATTACCTAGG + Intronic
1069559564 10:69419936-69419958 TGGCACCCCCAGCATTGCCCTGG - Intergenic
1069952092 10:72026076-72026098 CAGCAGCATCAGCATCACCAGGG - Intergenic
1070401045 10:76053861-76053883 TAGCAGCATCAGCATCACCTGGG + Intronic
1070407181 10:76107336-76107358 CAGCAGCCTCAGCATCACCTGGG - Intronic
1070654005 10:78258538-78258560 TGGCAGCCCAAGCTGTACCAGGG - Intergenic
1070938731 10:80323547-80323569 TAGCAGCCTCAGCATCACCTGGG + Intergenic
1071120362 10:82269816-82269838 CAGCAGCATCAGCATTACCTGGG - Intronic
1071921631 10:90356970-90356992 TGGCAGACCCACCTTTACCAAGG + Intergenic
1072915148 10:99533195-99533217 CAGCAGCACCAGCACTTCCATGG + Exonic
1073560026 10:104488598-104488620 TCTGAGCCCCAGCATTAACAGGG - Intergenic
1073620564 10:105043267-105043289 TAGCAGCATCAGCATCACCTGGG + Intronic
1074430995 10:113394565-113394587 TAGCAGCAACAGCATCACCTGGG - Intergenic
1077032808 11:477317-477339 TGTCAGCCACAGCATTTCCAGGG + Intronic
1078650982 11:13191848-13191870 TAGCAGCCCAAGCTATACCTTGG + Intergenic
1078914394 11:15765068-15765090 CAGCAGCTTCAGCATTACCTGGG + Intergenic
1078949617 11:16115531-16115553 CAGCAGCCCCAGCTTCACCTGGG - Intronic
1079291505 11:19192203-19192225 AAGCAGCATCAGCATTACCTGGG - Intronic
1080923263 11:36730343-36730365 TAGCAGCATCAGCCTTACCCGGG + Intergenic
1081002165 11:37688513-37688535 TAGCAGCACCAGCAGCACCAGGG + Intergenic
1081354397 11:42095174-42095196 CAGCAGCCCAAGCAGTACCTTGG - Intergenic
1083955941 11:65982766-65982788 TAGCAACCTCTGCATTGCCAGGG - Intergenic
1085267310 11:75244576-75244598 TGACAGCCCCAGCTTTGCCATGG + Intergenic
1085851021 11:80120219-80120241 TAGCAGCATCAGCATCACCTGGG + Intergenic
1087274857 11:96150896-96150918 TAGCAGCATCAGCATCACCTGGG + Intronic
1089131122 11:116213020-116213042 TGGCAGCTCTAGCATTACCTGGG - Intergenic
1089429887 11:118414112-118414134 CAGCAGCATCAGCATCACCAGGG + Intronic
1090954925 11:131505392-131505414 CAGCAGCCTCAGCATTACCTGGG + Intronic
1099470864 12:83046333-83046355 TGGCAGCATCAGCATCACCAGGG + Intronic
1099987579 12:89685510-89685532 TAGCAGTATCAGCATCACCATGG + Intronic
1100784837 12:98067906-98067928 CAGCAGCAGCCGCATTACCAAGG - Intergenic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1106234797 13:27852734-27852756 CAGCAGCACCAGCATCACCTTGG - Intergenic
1106466684 13:30019967-30019989 CAGCACCCCCAGCCTTTCCAGGG + Intergenic
1106686718 13:32067977-32067999 CAGCAGCACCAGCATCACCTGGG + Intronic
1108575813 13:51789496-51789518 CAGCAGCCTCAGCATCACCTGGG - Intronic
1110416268 13:75256549-75256571 CAGCAGCATCAGCATTACCTAGG + Intergenic
1113656169 13:112068766-112068788 TCGCTGCCGCAGCACTACCAGGG + Exonic
1113992111 14:16035763-16035785 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1114207293 14:20584270-20584292 TACCAGCCTCAGCATGTCCAAGG - Exonic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1118161726 14:63297544-63297566 CAGCAGCGTCAGCATTACCTGGG + Intergenic
1119466742 14:74864162-74864184 CAGCAGCATCAGCATTACCTGGG - Intronic
1120009865 14:79401360-79401382 AGGCAGCACCAGCATCACCAGGG + Intronic
1120970158 14:90200399-90200421 TCGCAGCCCCCTCATTTCCATGG - Intergenic
1202847383 14_GL000009v2_random:192258-192280 TAGCAGCATCAGCATCACCTGGG - Intergenic
1202875939 14_KI270722v1_random:380-402 TAGCAGCAACAGCATCACCTGGG + Intergenic
1125990208 15:44099344-44099366 AAGCAGCAGCAGCATTACCTGGG - Intronic
1126830599 15:52599766-52599788 TAGCAGCCCCCTCATAATCAGGG - Intronic
1127856550 15:62958334-62958356 AAGCAGCCTCAGCATCACCTGGG - Intergenic
1128378227 15:67092436-67092458 CAGCAGCGTCAGCATCACCAGGG + Intronic
1128978535 15:72169994-72170016 TAACAGCCCCACCATGCCCATGG + Intronic
1129454867 15:75671244-75671266 TGGCAGCACCGGCATTACCTGGG - Intergenic
1129695056 15:77735725-77735747 CAGCAGCATCAGCATTACCTGGG - Intronic
1130260545 15:82350754-82350776 TAGCAGCTCCAGCAGCACCTGGG + Intergenic
1130280687 15:82518250-82518272 TAGCAGCTCCAGCAGCACCTGGG - Intergenic
1130403473 15:83578328-83578350 TCTCAGCCCCAGCATTAGTATGG + Intronic
1130472059 15:84234433-84234455 TAGCAGCTCCAGCAGCACCTGGG - Intergenic
1130479553 15:84349004-84349026 TAGCAGCTCCAGCAGCACCTGGG - Intergenic
1130492217 15:84439125-84439147 TAGCAGCTCCAGCAGCACCTGGG + Intergenic
1130594358 15:85239073-85239095 TAGCAGCTCCAGCAGCACCTGGG - Intergenic
1130839838 15:87687917-87687939 TAGCAGCATCAGCATCACCCAGG + Intergenic
1130973820 15:88757446-88757468 GAGCATGCCCAGCATTACCCTGG - Intergenic
1131255098 15:90856809-90856831 CAACAGCCTCAGCATTTCCAAGG - Intergenic
1131348890 15:91678506-91678528 TAGCAGCAGAAGCATCACCAGGG + Intergenic
1134070617 16:11257367-11257389 GAGGAGCCCCAGCATCACAAGGG + Intronic
1135183600 16:20295872-20295894 CAGCAGCATCAGCATTACCTGGG - Intergenic
1135635978 16:24076106-24076128 TAGCAGCGTCAGCATCACCTGGG - Intronic
1135856959 16:26020588-26020610 CAGCAGCACCAGCATCACCTAGG - Intronic
1136911486 16:34147734-34147756 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1138100779 16:54250546-54250568 CAGCAATCCCAGCATTCCCAGGG + Intronic
1139854116 16:69967230-69967252 CAGCAGCCTCAGCATCACCAGGG + Intergenic
1139883097 16:70190144-70190166 CAGCAGCCTCAGCATCACCAGGG + Intergenic
1140369411 16:74405376-74405398 CAGCAGCCTCAGCATCACCAGGG - Intergenic
1141234451 16:82202672-82202694 CAGCATCCCCAGCATTAACATGG - Intergenic
1141507115 16:84485171-84485193 CAGCAGCCTCAGCCTTGCCACGG - Intronic
1143968811 17:10777511-10777533 TGGCAGCACCAGAATTTCCAGGG + Intergenic
1144247282 17:13379540-13379562 CAGCAGCCCCATCAATAGCAGGG - Intergenic
1145188242 17:20814763-20814785 TAGCAGCCCCAGCATCACGTTGG + Intergenic
1146736810 17:35245014-35245036 TAGCAGCCCCACTTTAACCATGG + Intronic
1147584055 17:41642831-41642853 TAGCTGCATCAGCATTTCCAGGG + Intergenic
1148717963 17:49729294-49729316 CAGCAGCCCTGGCATTCCCAGGG - Intronic
1149781842 17:59403755-59403777 AAGCAGCACCAGAATTAACATGG - Intergenic
1150078672 17:62216905-62216927 TAGCAGCCCCAGCATCACTTTGG - Intergenic
1151003317 17:70403721-70403743 TAGCAGCATCAGCATCACCTAGG - Intergenic
1151096808 17:71508034-71508056 GAGCAGCCTCAGCATCACCTGGG - Intergenic
1151902021 17:77022585-77022607 CAGCAGCCCCAGCTGTACCTGGG - Intergenic
1152307954 17:79532119-79532141 TGGCAGCGCCAGAATTACCCTGG + Intergenic
1152897840 17:82923501-82923523 GAGCAGCCCCTGCCTGACCAGGG - Intronic
1153512895 18:5874589-5874611 CAGCAGCACCAGCATCACCTGGG - Intergenic
1157226315 18:45868245-45868267 CAGCAGCATCAGCATTACCTGGG - Intronic
1158312468 18:56172964-56172986 CAGCAGCATCAGCATTACCTGGG - Intergenic
1160202759 18:76808952-76808974 TAGCAGCCCCAGCATTACCAAGG - Intronic
1160310557 18:77786304-77786326 TAGCAGCCACTGCAATACAAAGG + Intergenic
1160921268 19:1521894-1521916 TGCCAGCCCCAGCAGTCCCAGGG - Intergenic
1161951292 19:7469523-7469545 GAGCAGCCCCAGTGTTTCCACGG + Intronic
1163550196 19:17962246-17962268 TAGCAGCTCCATCATAAGCAAGG - Intronic
1164508145 19:28876062-28876084 CAGCAGGCTCAGCATCACCACGG + Intergenic
1166194086 19:41194705-41194727 TAGCAGCCCTTGACTTACCATGG - Exonic
1202674726 1_KI270710v1_random:32430-32452 TAGCAGCAACAGCATCACCTGGG - Intergenic
925413963 2:3656638-3656660 CAGCAGCCCCAGCATCGCCCTGG + Intergenic
928170672 2:29001078-29001100 GAGCAGCCCCAGCACTGCCCGGG - Intronic
929615481 2:43303927-43303949 CAGCAGCATCAGCATTACCTGGG - Intronic
930358932 2:50353955-50353977 TAGCAGCTTCAGCATCACCTGGG - Intronic
930810007 2:55530405-55530427 TAGCAGCTTCAGCATCACCTGGG - Intronic
931585155 2:63818166-63818188 TAGCAGCCTAAGCAATCCCAAGG + Intronic
934930623 2:98419654-98419676 CAGCAGCATCAGCATCACCAGGG - Intergenic
935197377 2:100825629-100825651 CAGCAGCCCCACCCTCACCAGGG - Intronic
935557489 2:104526250-104526272 CAGCAGCATCAGCATCACCAGGG - Intergenic
937293876 2:120798381-120798403 CAGCAGCCCCAGCATCATCTTGG - Intronic
938539623 2:132275496-132275518 TGGCAGCCCCAGCATTGTAAAGG - Intergenic
939794540 2:146625956-146625978 CAGCAGCTCCAGCATTACCTGGG + Intergenic
941223910 2:162820967-162820989 TAGCAGCCCCAGCTTTTTCAGGG + Intronic
941689437 2:168483945-168483967 TAGCAACATCAGCATAACCAGGG - Intronic
943184159 2:184585025-184585047 TAGCAGCCTCAGCATCCCCTGGG + Intergenic
944691700 2:202164543-202164565 TGGCATCCTCAGGATTACCACGG - Intronic
944711912 2:202342131-202342153 TAGCAGCCCCAGTATTCCTGGGG - Intergenic
944912918 2:204327917-204327939 CAGCAGCCTCAGCATCACCTGGG + Intergenic
945508578 2:210672144-210672166 GAGCAGCATCAGCATTACCTGGG - Intronic
945920723 2:215752293-215752315 CAGCAGCCTCAGCATCACCTGGG + Intergenic
947522869 2:230862044-230862066 CAGCAGCCCCAGCAGCACCTGGG - Intergenic
947544248 2:231000246-231000268 CAGCAGCTGCAGGATTACCAGGG - Intronic
1168736690 20:146102-146124 CAGCAGCCCTAGCATCACCTGGG - Intergenic
1169375207 20:5061374-5061396 TGGCAGCATCAGCATTACCTGGG + Intergenic
1169748388 20:8965943-8965965 CAGCAGCAACAGCATCACCAGGG + Intronic
1169847729 20:10013783-10013805 CAGCAGCAACAGCATTACCTGGG + Intronic
1169868882 20:10230497-10230519 TAGCAGCATCAGCATCACCCAGG + Intronic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1170501250 20:16976682-16976704 TTGCAGCTCCATCATTGCCATGG - Intergenic
1171309996 20:24138316-24138338 CAGCAGCCTCAGCACTGCCAGGG - Intergenic
1171425311 20:25045087-25045109 TAGCAGCTACATCATTATCACGG + Intronic
1171785425 20:29459455-29459477 GAGCAGCCCCAAGTTTACCAAGG + Intergenic
1171862889 20:30417730-30417752 GAGCAGCCCCAAGTTTACCAAGG - Intergenic
1171868550 20:30508405-30508427 TGGCAGCCCCAGCATTGTAAAGG - Intergenic
1171906812 20:30906011-30906033 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1172829149 20:37817731-37817753 CAGCAGCCTCAGCGTTACCTGGG - Intronic
1173912416 20:46680137-46680159 CAGCAGCCTCAGCATCACCTGGG + Intronic
1173973936 20:47173179-47173201 TAGCAGCGACAGCATCACCTGGG + Intronic
1176551457 21:8224209-8224231 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1176570366 21:8407208-8407230 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1176578275 21:8451395-8451417 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1176637212 21:9257750-9257772 TAGCAGCAACAGCATCACCTGGG + Intergenic
1176864274 21:14035040-14035062 CAGCAGCATCAACATTACCAGGG + Intergenic
1178036112 21:28584745-28584767 TATCAGCCCCAGCTTTACATAGG - Intergenic
1178674571 21:34620274-34620296 CAGCAGCCCCAGCATCTCCAGGG + Intergenic
1179321976 21:40300858-40300880 CAGCAGCCTCAGCATCACCTGGG - Intronic
1180315160 22:11271764-11271786 TGGCAGCCCCAGCATTGTAAAGG - Intergenic
1180340226 22:11612085-11612107 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1183100103 22:35578668-35578690 CAGCAGCTACAGCCTTACCATGG + Intergenic
1184804313 22:46782657-46782679 TAGCAGCCCCATGGTTGCCAAGG - Intronic
1185086093 22:48741829-48741851 CAGCAGCTCCAGCAATAACACGG + Intronic
1203256479 22_KI270733v1_random:141153-141175 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
949388280 3:3530110-3530132 TAGCAGCCTCAGCATCACCTGGG + Intergenic
949746190 3:7294720-7294742 TAGCAGCATCAGCATCACCTGGG + Intronic
949829999 3:8204109-8204131 CAGCAGCATCAGCATTACCCAGG - Intergenic
950117258 3:10459395-10459417 CACCATCCCCAGCATTCCCACGG - Intronic
951168375 3:19508671-19508693 CAGCAGCACCAGTATTACCTGGG + Intronic
951372417 3:21866634-21866656 CAGCAGCATCAGCATTACCTGGG - Intronic
951689575 3:25381712-25381734 CAGCAGCATCAGCATTACCTGGG + Intronic
952266764 3:31794474-31794496 TAGGAGCCTCAGCACAACCATGG - Intronic
952622480 3:35362154-35362176 TAGCAGCATCAGCATTACCTGGG - Intergenic
952662725 3:35871124-35871146 CAGCAGCAGCAGCATTGCCAGGG + Intergenic
952829988 3:37556652-37556674 CAGCAGCACCAGCGTCACCAGGG - Intronic
952903776 3:38126564-38126586 TATCCGCCCCAGCACCACCATGG - Exonic
954642364 3:52108731-52108753 CAGCAGCCCCACGATTCCCAGGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
955661829 3:61307666-61307688 CAGCAGCATCAGCATTACCTGGG + Intergenic
955950855 3:64240695-64240717 CAGCAGCCTCAGTATCACCAGGG + Intronic
956349192 3:68315794-68315816 TAGCAGCCCAAGTATTAACATGG - Intronic
956362212 3:68460800-68460822 TAGCAGCATCAGCATCACCTGGG - Intronic
956423865 3:69112729-69112751 AAGCAGCAGCAGCATTACCAGGG + Intronic
957103680 3:75859195-75859217 TAGCAGCATCAGCATCACCTGGG - Intergenic
958114189 3:89193343-89193365 TAGCGGCCTTGGCATTACCATGG + Intronic
958919101 3:100083351-100083373 CAGCAGCATCAGCATTACCTGGG + Intronic
959330915 3:105003442-105003464 AAGCAGCAACAGCATTACAAAGG - Intergenic
962898603 3:139737523-139737545 TAGCAGCCCCAGGAATCCCTAGG + Intergenic
963103531 3:141626284-141626306 TAGCAGCATCAGCATTACCTGGG + Intergenic
963258028 3:143165726-143165748 CAGCAGCAACAGCATTACCTGGG - Intergenic
965313418 3:167160144-167160166 TAGAAGGGCCAGCATTCCCATGG - Intergenic
966266819 3:178056094-178056116 CAGCAGCTCCAGCATTCCCTGGG + Intergenic
966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG + Intergenic
967214029 3:187194921-187194943 CAGCATCCCCAGCAGTAGCAGGG + Intergenic
967416302 3:189222513-189222535 CAGCAGCACCAGCATCACCTGGG + Intronic
1202749682 3_GL000221v1_random:147269-147291 TAGCAGCAACAGCATCACCTGGG - Intergenic
968509608 4:989655-989677 CAGCAGCACCAGCAGCACCACGG + Exonic
969568847 4:7996151-7996173 TAGCAGCCCCAACCTTGCCAGGG + Intronic
969969108 4:11027817-11027839 TAGAAGTCACAGCATTTCCATGG + Intergenic
970591691 4:17565579-17565601 CAGCAGCCCCACCATGCCCACGG + Intergenic
980095375 4:128484608-128484630 TGGCCTCACCAGCATTACCAGGG - Intergenic
983823392 4:172225820-172225842 CAGCAGCATCAGCATTACCTGGG - Intronic
984779363 4:183510219-183510241 TAGCAGACACAACATTTCCAAGG - Intronic
1202752105 4_GL000008v2_random:16177-16199 TAGCAGCAACAGCATCACCTGGG + Intergenic
986697748 5:10373683-10373705 TAGCAGCCACAGCATGACAAAGG - Intronic
986741558 5:10709993-10710015 GAGCAGCGCCAGCATCACCTGGG - Intronic
989168495 5:38453058-38453080 CAGCAGCCCCAGCATCACCTGGG + Intronic
990104341 5:52238117-52238139 TAGCAGCCACAGCTTTCTCAAGG - Intergenic
991357032 5:65779258-65779280 TAGGAGCATCAGCATCACCAGGG - Intronic
992666295 5:79012747-79012769 CAGCAGCCCAAGCTTTACTAGGG + Intronic
994457325 5:100027997-100028019 TAGAAGCATCAGCATTACCTAGG - Intergenic
995053195 5:107730058-107730080 GAGCAGCATCAGCATTACCTAGG - Intergenic
997007924 5:129841865-129841887 TTGAGGCCCCAGCATTACGAAGG - Intergenic
997673127 5:135692752-135692774 TAGCAGAAACAGCATCACCATGG - Intergenic
999142724 5:149373126-149373148 CAGCAGCACCAGCATCACCTGGG + Intronic
999708906 5:154298932-154298954 AAGCAGCGCCAGCATCCCCAGGG - Intronic
999806502 5:155086312-155086334 TGGCAGCACCAGCATCACCTGGG - Intergenic
1000023271 5:157337392-157337414 TAGCAGCTCCACCTTTACCTGGG + Intronic
1005595185 6:27372417-27372439 CAGCAGCACCAGCATCACCCGGG + Intergenic
1006751724 6:36382395-36382417 CAGCAGCATCAGCATTACCCAGG + Intronic
1007497921 6:42274109-42274131 TAGCAGCCCCAGGATCACCTGGG + Intronic
1007530157 6:42534984-42535006 CTGCTACCCCAGCATTACCAGGG - Intergenic
1007678410 6:43617244-43617266 CAGCAGCCTCAGTATCACCAGGG + Intronic
1008037263 6:46758885-46758907 CACCAGGCCCAGCAATACCAAGG + Exonic
1010020860 6:71158493-71158515 CAGCAGCCTCAGCATCACCTGGG - Intergenic
1016909325 6:149181784-149181806 TAGCAGCTTCAGCATTAATATGG - Intergenic
1021352550 7:19612959-19612981 CAGCAGTCCCAGTTTTACCATGG + Intergenic
1021603696 7:22389922-22389944 GGGCAGCCTCAGCATTACCTGGG - Intergenic
1021822651 7:24513540-24513562 TAGCAGCATCAGCATTACCTGGG - Intergenic
1022403886 7:30068210-30068232 CAGCAGCCTCAGCATCACCTGGG - Intronic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1022771270 7:33475451-33475473 TCACAGCCTCAGCATTACCTGGG - Intronic
1022826300 7:34017764-34017786 CAGCAGCCTCAGCATTACTTGGG - Intronic
1023202230 7:37711272-37711294 TGGCAGCATCAGCATCACCAGGG - Intronic
1024428806 7:49262082-49262104 CGGCACCCCCAGCAATACCAGGG + Intergenic
1024983838 7:55179361-55179383 AAGCAGCCTCAGCATTGCCTGGG - Intronic
1026405382 7:70060374-70060396 TAGCAGCCTCAGCTTTACTTGGG + Intronic
1026464692 7:70644025-70644047 CAGCAGCCTCAGCATCACCAAGG - Intronic
1026677052 7:72436747-72436769 AAGCAGCCTCAGCATCACCTGGG + Intronic
1027527393 7:79287122-79287144 TAGCAGCATCAGCATCACCTGGG + Intronic
1029480146 7:100807347-100807369 TATTACCCCCAGCATTACCAGGG + Exonic
1029899677 7:104025613-104025635 TGACAGCCCCACCATTACCAAGG + Intergenic
1030495186 7:110289836-110289858 TAGCAGCACCAGCAGCACCTGGG + Intergenic
1031514588 7:122686582-122686604 GAGCAGCCTCAGCATCACCTGGG - Intronic
1031596847 7:123658784-123658806 CAGCAGCATCAGCATTACCTGGG + Intronic
1031941375 7:127792989-127793011 TCCCTGCCCCAGCATCACCAAGG + Intronic
1032848626 7:135773205-135773227 CAGCAGCACCAGCATCACCTGGG + Intergenic
1033825019 7:145178851-145178873 TTCCAGCCCCAGCATTCTCAAGG + Intergenic
1038409266 8:27345466-27345488 GAGCAGCCCCACCATTCCCCAGG - Intronic
1038440291 8:27566670-27566692 TAGAAGCTTCAGCATTGCCAGGG + Intergenic
1044789718 8:95835011-95835033 CATCAGCACCAGTATTACCAGGG + Intergenic
1045173973 8:99700284-99700306 TAGCAGCATCAGCATCACCTGGG + Intronic
1048038539 8:130701798-130701820 TTGGAGCCCCAGCAGTGCCATGG + Intergenic
1048562588 8:135557566-135557588 TACCAGCCCCAGCAATAACCAGG + Exonic
1049346685 8:142142929-142142951 TACCAGCACCACCATCACCATGG - Intergenic
1049640265 8:143712120-143712142 TCACAGCCCCAGCAGTTCCAGGG - Intronic
1049930909 9:455589-455611 TAGCAGCAGCAGCATCACCTGGG - Intronic
1051184853 9:14449593-14449615 TTTCAGCCCCAGCATGAACAGGG - Intergenic
1052024451 9:23559063-23559085 TAGCAGCATCAGCATCACCTGGG - Intergenic
1055670234 9:78597620-78597642 TACCACCCCCAGCTTTACTAAGG + Intergenic
1056202030 9:84286125-84286147 TAGCAATTCCAGAATTACCAAGG + Intronic
1056384018 9:86080699-86080721 AAGCACCCCCAGAATTCCCACGG + Intronic
1056385849 9:86096459-86096481 TAGCAGCATCAGCATTACCTTGG + Intronic
1056464487 9:86840251-86840273 CAGCAGCATCAGCATTACCTGGG - Intergenic
1056905646 9:90645432-90645454 AAGCAGCATCAGCATTACCAGGG - Intergenic
1059217677 9:112581443-112581465 TATCACCACCAGCATTACCTGGG + Intronic
1059522926 9:114960896-114960918 AAGCAGCATCAGCATTACCTGGG - Intergenic
1059780700 9:117523284-117523306 CAGCAGCACCAGCAGTACCTGGG - Intergenic
1061944335 9:133900288-133900310 TCTGAGCCCCAGTATTACCAGGG - Intronic
1062118690 9:134822552-134822574 TGGGAGACCCAGCATTCCCAGGG + Intronic
1203446204 Un_GL000219v1:58685-58707 GAGCAGCCCCAAGTTTACCAAGG + Intergenic
1203472636 Un_GL000220v1:122853-122875 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1203718325 Un_KI270742v1:177357-177379 TAGCAGCAACAGCATCACCTGGG - Intergenic
1203532891 Un_KI270743v1:865-887 TAGCAGCAACAGCATCACCTGGG + Intergenic
1203652539 Un_KI270751v1:141050-141072 TAGCAGCATCAGCATCACCTGGG - Intergenic
1186839342 X:13469515-13469537 TAGCAGCATCAGCATCACCTTGG - Intergenic
1186926667 X:14340683-14340705 TAGCAGCATCAACATTATCAGGG + Intergenic
1187726158 X:22204214-22204236 CAGCAGCATCAGCATCACCAGGG - Intronic
1187966213 X:24614941-24614963 TAGCAGCAGCAGCATCACCTGGG + Intronic
1189741395 X:44120595-44120617 CAGCAGCCTCAGCATCACCTGGG + Intergenic
1190075824 X:47316454-47316476 GGGCAGCCCCTGCGTTACCATGG - Intergenic
1190456998 X:50636229-50636251 AAGCAGCCCCAGCAGCACCTGGG - Intronic
1191025823 X:55912103-55912125 CAGCAGCATCAGCATCACCAGGG + Intergenic
1192298837 X:69879539-69879561 TGGCAGCATCAGCATTAGCAGGG - Intronic
1194744746 X:97616057-97616079 CAGCAGCATCAGCATCACCAGGG + Intergenic
1196111440 X:111951262-111951284 TAGCAGCATCAGCATTACCTGGG - Intronic
1197025296 X:121740490-121740512 TAGCAGGGCCAGCATTTCCTGGG - Intergenic
1197730074 X:129802265-129802287 TAGCAGCCCTAGCACTCCCTTGG + Intergenic
1201074861 Y:10179165-10179187 TGGCAGCCCCAGCATTGTAAAGG + Intergenic
1201172476 Y:11282207-11282229 TAGCAGCAACAGCATCACCTGGG - Intergenic