ID: 1160205507

View in Genome Browser
Species Human (GRCh38)
Location 18:76828139-76828161
Sequence CAGTGTAAGCTAGGGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160205500_1160205507 -5 Left 1160205500 18:76828121-76828143 CCCAAGGGGAGGCACCACCAGTG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1160205507 18:76828139-76828161 CAGTGTAAGCTAGGGGTAGTAGG 0: 1
1: 0
2: 0
3: 11
4: 84
1160205501_1160205507 -6 Left 1160205501 18:76828122-76828144 CCAAGGGGAGGCACCACCAGTGT 0: 1
1: 0
2: 2
3: 12
4: 140
Right 1160205507 18:76828139-76828161 CAGTGTAAGCTAGGGGTAGTAGG 0: 1
1: 0
2: 0
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160205507 Original CRISPR CAGTGTAAGCTAGGGGTAGT AGG Intronic
908093819 1:60715918-60715940 CAGTGGTTGCTAGGGGTTGTGGG - Intergenic
908598642 1:65715114-65715136 CAGAGTCTGCTAAGGGTAGTAGG + Intergenic
911496428 1:98637426-98637448 CAGTGTACTGTAGGGGTATTTGG + Intergenic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916660044 1:166915201-166915223 CAGAGTACGCTAGTGGTAGTGGG - Exonic
923498547 1:234545449-234545471 CAGTGTGAGCCTGGGGGAGTGGG - Intergenic
923806260 1:237261412-237261434 CAGACTAGGCTAGGGGAAGTGGG - Intronic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1070586399 10:77770101-77770123 CAGTGAAAGGTTGGGGCAGTGGG + Intergenic
1075273342 10:121072115-121072137 CATTGTGACCTAGGGGTAGCAGG - Intergenic
1078860474 11:15242154-15242176 CAGTGTCAGGCAGTGGTAGTTGG - Intronic
1098790927 12:74820741-74820763 CAGTGTGAGGTAGGGGTTGGGGG + Intergenic
1112693538 13:101921223-101921245 CAGTGTTAATTAGGGGTAGGTGG - Intronic
1116646275 14:47533162-47533184 CATTCTAAGCTATGTGTAGTGGG - Intronic
1117379018 14:55141451-55141473 CAGTGTGCGTTAGGGGTTGTGGG - Intronic
1118920177 14:70143025-70143047 CAGGGTAAGCTGGGGGTAGCTGG - Intronic
1120253611 14:82090527-82090549 CAGTGTCAGCTAATGGTAGAAGG + Intergenic
1121452438 14:94017731-94017753 CAGTGCAAGCTGGGGGTCGAAGG - Intergenic
1122087880 14:99319798-99319820 CAGTGTAAGACAGGGGTAAGGGG - Intergenic
1122444376 14:101758600-101758622 CAGTGTGTTCTACGGGTAGTCGG + Intergenic
1128465644 15:67908880-67908902 CAGTGTAGGATAGGGATAGGAGG - Intergenic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1131398055 15:92102584-92102606 CAGTGTAAGCCTGGAGTACTTGG - Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1137985263 16:53101955-53101977 CAGTGTAAGGAATGGGTCGTAGG + Intronic
1141793925 16:86256752-86256774 CAGTGTAAGGTGGAGCTAGTGGG - Intergenic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1144599865 17:16601976-16601998 CAGTGGTAGCTAGGGGTTGGGGG + Intergenic
1145939910 17:28737867-28737889 CAGTGTATGCCTGGGGTGGTGGG + Exonic
1152891742 17:82885817-82885839 CAGGGTAAGCTAGGTGCACTCGG - Intronic
1157988465 18:52466916-52466938 CTGTGTAAGCTTGGGCAAGTTGG - Intronic
1159405422 18:67996074-67996096 CTTTGTAAGCTAGGAGCAGTAGG - Intergenic
1160205507 18:76828139-76828161 CAGTGTAAGCTAGGGGTAGTAGG + Intronic
1165232051 19:34393355-34393377 CAGTCTAAGGTCGGGGTAGGGGG + Intronic
1166051698 19:40264529-40264551 CAGTGTGAGCTAGGGCGAGCTGG - Intronic
925459051 2:4044202-4044224 CAGTGTAAGCAAGAGGTAGAAGG + Intergenic
929810092 2:45182516-45182538 CAGTGAAGGCAAGGGGTGGTGGG + Intergenic
937635466 2:124151042-124151064 AAGTGTCTGCTAGGGGTAGCAGG + Intronic
937940402 2:127280811-127280833 CAGTGTAGGCTGGGTGCAGTGGG - Intronic
939007401 2:136805504-136805526 CAGTGTTAGCTATGTGTAGGTGG + Intronic
942451379 2:176109781-176109803 CAGTGTAACCTAGAGGTGGTGGG - Intronic
942482058 2:176399136-176399158 CAGTGTAAGCCAAAGGCAGTGGG + Intergenic
946963180 2:225006614-225006636 CAGTGTGTGATAGGTGTAGTAGG - Intronic
947885379 2:233565623-233565645 AAGTGTAAGGTAGGGGGATTTGG - Intronic
1170613082 20:17929767-17929789 CAGGGCAAGCTGGGGTTAGTGGG - Intergenic
1174306146 20:49615664-49615686 CAGTGTCACCTAGAGGTCGTAGG - Intergenic
1174828031 20:53786692-53786714 CAGGGTAAGTTAGAGGTAGTAGG - Intergenic
1180638437 22:17279069-17279091 CAGAGTAAGCCAGGCGCAGTGGG - Intergenic
1182073082 22:27477001-27477023 GGCTGTAAGCTAGGGGTGGTGGG + Intergenic
1184329746 22:43819818-43819840 CAGTGTAAGCTGGGTCAAGTCGG + Intergenic
953267909 3:41411113-41411135 CAATGTGAACTAGGGGTAGAAGG + Intronic
956771398 3:72529055-72529077 CAGCGGTAGCTAGGGGTTGTGGG + Intergenic
957353387 3:79053669-79053691 CAGTGTGAGAAAGGGGTATTGGG - Intronic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
962750718 3:138433177-138433199 GAGTGTAGGCTAGGGATACTGGG - Intergenic
975424269 4:74208108-74208130 CCTTCTAAGCTGGGGGTAGTGGG - Intronic
982381628 4:154755139-154755161 CAGTGTGAGTTAGCGGCAGTAGG - Intergenic
983054817 4:163089419-163089441 CAGTGAGAGCTAGGGATAGTGGG + Intergenic
989000656 5:36756940-36756962 CAGTGTAAGGAAGGGGAAGTTGG + Intergenic
991938941 5:71831550-71831572 GAGTGGAGGCTATGGGTAGTAGG - Intergenic
995468328 5:112474218-112474240 CAGTCTAGGCTAGTGGTAGGTGG - Intergenic
995487799 5:112656764-112656786 GAGTGTAAGCTGGGGGGAATCGG + Intergenic
998558955 5:143153329-143153351 CAGTGGAAGATGGTGGTAGTGGG - Intronic
1003091594 6:3108540-3108562 CAGTGTAAGCTGGAGGTGGTGGG + Intronic
1003619484 6:7685383-7685405 CAGTGTAAACCAAGGGTGGTTGG - Intergenic
1005306569 6:24519831-24519853 CAGTGTAAGCTGTGGGTTGTGGG + Intronic
1005871305 6:29975960-29975982 AAGTGTAGGCTAGGGGTCCTGGG - Intergenic
1011261252 6:85472118-85472140 CAGTGCAAGGTGGGGGAAGTGGG - Intronic
1011972706 6:93247574-93247596 CAGTGTAAGGTAAGGGAACTTGG - Intronic
1013934974 6:115583091-115583113 CAGATTAAGGTAGGGGTATTGGG - Intergenic
1016893362 6:149028821-149028843 CAGCATAAGTTAAGGGTAGTTGG - Intronic
1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG + Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023633809 7:42188803-42188825 CACTGTTTGCTAGGGGTGGTAGG + Intronic
1028769217 7:94597237-94597259 GAGTGTAAGTAATGGGTAGTGGG - Intronic
1029799359 7:102930011-102930033 CAGTTTGGGCTAGGGGTGGTGGG + Intronic
1030809243 7:113955339-113955361 CAGTGTCAGCTTGGGGCAGGGGG + Intronic
1031351005 7:120731003-120731025 CAGAGTAAGCATGGAGTAGTTGG + Intronic
1034963281 7:155375212-155375234 CAGTGTAGGGGAGGGGAAGTAGG + Intergenic
1037153145 8:15664045-15664067 CATTGTAAGCTAGTAATAGTTGG + Intronic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1045045786 8:98276259-98276281 CAGTGGTTGCTAGGGGTTGTGGG - Intronic
1048301539 8:133254869-133254891 CAGGGTAAGCTAGCAGTAGCTGG - Intronic
1053188649 9:36040471-36040493 CAGAGTATGCTAGGGCTAGATGG + Intronic
1055146127 9:72936986-72937008 CAGTGAAACCTAGGGGAAGGTGG + Intronic
1055156204 9:73065948-73065970 TAGTGTAAGCTAGGTGAAGTTGG - Intronic
1055449657 9:76419381-76419403 AAGTGTAAGCTGGGCGTAGTGGG + Intergenic
1057480684 9:95442797-95442819 CTGTGTAAGCAAGGAGTGGTGGG - Intergenic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1186782333 X:12925460-12925482 AAGTGGAAGCTAGGGGAGGTGGG + Intergenic
1189019140 X:37316522-37316544 CTGTGAGAGCTAGGGGTAGAAGG - Intergenic
1190781077 X:53595506-53595528 AAGTGTTAACTAGGGGTTGTAGG - Intronic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1198209581 X:134504722-134504744 CAGTGGAAAGTAGGAGTAGTGGG - Intronic
1199808970 X:151330141-151330163 CACTGTAAGTTAGGGATTGTAGG + Intergenic