ID: 1160207775

View in Genome Browser
Species Human (GRCh38)
Location 18:76850292-76850314
Sequence TGTTCTCTAAAGGAGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160207775_1160207781 16 Left 1160207775 18:76850292-76850314 CCATGGACCTCCTTTAGAGAACA 0: 1
1: 0
2: 1
3: 9
4: 170
Right 1160207781 18:76850331-76850353 GGCTTGACTTTCAGCACAAATGG 0: 1
1: 0
2: 1
3: 11
4: 155
1160207775_1160207779 -5 Left 1160207775 18:76850292-76850314 CCATGGACCTCCTTTAGAGAACA 0: 1
1: 0
2: 1
3: 9
4: 170
Right 1160207779 18:76850310-76850332 GAACAGGATGTGACCATCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160207775 Original CRISPR TGTTCTCTAAAGGAGGTCCA TGG (reversed) Intronic
902831466 1:19016126-19016148 TGTTCTCAAAATGTGGTCCCTGG + Intergenic
912306024 1:108568370-108568392 GGTTATCAAATGGAGGTCCAAGG + Intronic
913320079 1:117581948-117581970 TGTTCTCAAAAAAATGTCCATGG + Intergenic
918552993 1:185765716-185765738 GGTTCTCAAAAGGTGGTCCCTGG + Intronic
919576412 1:199315631-199315653 AGGTCTCTAAGTGAGGTCCAGGG + Intergenic
920826725 1:209429808-209429830 TGTTTTCTCAAGGATTTCCAGGG + Intergenic
923777641 1:236994452-236994474 TGTTCTCTGAAGAAGGTCCCTGG - Intergenic
1064236811 10:13583554-13583576 AGTTCTCAAAATGAGGTCCCTGG + Intergenic
1064751467 10:18534399-18534421 TGTTCTCAAAGTGTGGTCCATGG + Intronic
1067197185 10:44132278-44132300 TTTCCCCTAAAGGAGGTCCTTGG + Intergenic
1067226510 10:44379735-44379757 AGTGCTGTAAAGCAGGTCCAAGG + Intronic
1069310036 10:67023442-67023464 CGTTCTCTATAGAAGATCCATGG - Intronic
1074086694 10:110213616-110213638 TGTCCTGGAAAGGAGATCCAGGG + Intronic
1075838349 10:125475403-125475425 TCTTCTCAACAGCAGGTCCATGG - Intergenic
1075911176 10:126126984-126127006 TCTGCTCTGAAGGAGATCCAAGG - Intronic
1076356731 10:129858629-129858651 TCTTCTCTAAAGGAGGCCCTTGG - Intronic
1077995969 11:7453080-7453102 TATTCTTTAAAGGAGTTTCAGGG - Intronic
1079218864 11:18540789-18540811 TGTACTCTGAGAGAGGTCCAAGG - Intronic
1080612871 11:33919998-33920020 TGTCACATAAAGGAGGTCCAGGG - Intergenic
1080768280 11:35317009-35317031 GGTTCTCTAAATGTGGTCCATGG + Intronic
1088061581 11:105657865-105657887 TTTTCTTTAAAGGAGGTATATGG + Intronic
1088646757 11:111923733-111923755 AGTTCTCTAAAGGATGTTAAAGG + Intronic
1089921509 11:122213497-122213519 CGTTCTCTGATGGTGGTCCAGGG + Intergenic
1091360176 11:134973208-134973230 TCTTCAGTAAAGGTGGTCCATGG - Intergenic
1092500036 12:9036296-9036318 TGATCTCCTAAGGAGGGCCACGG - Intergenic
1093246151 12:16739581-16739603 TGTTGTCTAACGTATGTCCAAGG + Intergenic
1093766716 12:22971771-22971793 TGTTCGCAAAAGGAGATCTAAGG + Intergenic
1095994058 12:48063615-48063637 TTTTCTCAAAATGTGGTCCATGG - Intronic
1100254481 12:92869156-92869178 TTTTTTCTAAATGATGTCCAAGG + Intronic
1100563403 12:95771381-95771403 TGTTCTGTTAAGGAGGACAAGGG - Intronic
1105761239 13:23516331-23516353 TGAAGTCTTAAGGAGGTCCAGGG + Intergenic
1107822715 13:44300821-44300843 TCTTCTCTAATGTAGGCCCAGGG + Intergenic
1108726496 13:53188577-53188599 TGAGCTGTAAAGGAGGGCCAAGG - Intergenic
1109162017 13:58987223-58987245 TGTTCTCTAAAAGGAGACCATGG - Intergenic
1110507066 13:76299290-76299312 TTTTTTCAAAAGGAGGTCCTTGG + Intergenic
1116389948 14:44380119-44380141 TGTTCTTTCAAGGAAGTCCCAGG + Intergenic
1117909382 14:60622170-60622192 TTTTCTCAAAAGGAATTCCAAGG - Intergenic
1118726570 14:68633125-68633147 TGTCCTCAAAAAGAGGCCCAGGG - Intronic
1118895033 14:69938727-69938749 TGTTCCCCAAAGGAGGTGAATGG - Intronic
1121015148 14:90544508-90544530 TTCCCTCTTAAGGAGGTCCAAGG - Intronic
1121932595 14:97986316-97986338 TGTTCTCTACACAAGGACCATGG - Intergenic
1124871342 15:33546074-33546096 TGTTCTCTAAAACAATTCCAAGG - Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126149824 15:45513837-45513859 AGTTCCCTAAAGGACGTGCAAGG + Intronic
1127262503 15:57336606-57336628 TGTTTTCCTGAGGAGGTCCAGGG + Intergenic
1131704869 15:94982884-94982906 TGTTCTCTACATAATGTCCAGGG - Intergenic
1133996311 16:10751209-10751231 TGTTCCCTAAAGGAAGGGCATGG + Intronic
1135097627 16:19577751-19577773 TGCCCTATAAAAGAGGTCCAAGG + Intronic
1135148044 16:19980240-19980262 TTTTCTCTAAAGGTGGTCCATGG + Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1140378802 16:74468028-74468050 TGTTTTGCAAAGAAGGTCCAAGG - Intronic
1144033562 17:11343263-11343285 TCTCCTCTAAAAGAGGACCAGGG - Intronic
1144330455 17:14219111-14219133 GGTTCCCCTAAGGAGGTCCACGG - Intergenic
1146138277 17:30342350-30342372 TGTTCTCTCAAGAAGTTCAAAGG + Intergenic
1147053106 17:37812752-37812774 TGTTCTCTAGAGAAGATACACGG - Intergenic
1153444562 18:5156751-5156773 TGTGCTTTAAAGCAGCTCCATGG + Intronic
1153784102 18:8518919-8518941 TTTTCTCTGAAGAAGATCCAAGG + Intergenic
1153980161 18:10302071-10302093 TCTTCTCCAAATGAGCTCCATGG - Intergenic
1156305683 18:35876037-35876059 TCTTCTCTAAAGGGGGTCTTTGG + Intergenic
1156809927 18:41235818-41235840 CGTTCTCTAAGAGAGCTCCATGG + Intergenic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1157822136 18:50779781-50779803 TGTTTTTTAAAGGAGTCCCAAGG - Intergenic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1162795863 19:13087373-13087395 TGTTCTCTCAAGAATGGCCAGGG - Intronic
1163373201 19:16914120-16914142 GATTCTCTGAAGGAGGTCTAGGG + Intronic
1167942828 19:52961569-52961591 TTTTCTCTAACGGGGGTCTAGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926884505 2:17584883-17584905 TGTTTTCTAGAGGAGGCCCAAGG - Intronic
927972723 2:27315937-27315959 CCTTCTCTCAAGGAGGACCAAGG + Intronic
929037797 2:37711418-37711440 TCATCTCAAAAGGAGGTGCAGGG - Intronic
930259141 2:49124775-49124797 TGTTGACTAAAGGAGGTCAAAGG - Intronic
930610579 2:53538718-53538740 GATTCTTTAAAGGTGGTCCATGG - Intronic
931954092 2:67398057-67398079 TCTTCTCTAAAGCAGGTCACAGG - Intronic
933501482 2:83117638-83117660 TGTTCTGTAAATGAGCTCCAGGG - Intergenic
934780633 2:96967622-96967644 TGTTCCCTATAGGAAGTCGAGGG + Exonic
935474694 2:103504286-103504308 AGTTCTCTAAAGAATGTCAATGG - Intergenic
935920467 2:108007218-108007240 TATTCTGTAAAGGTGATCCAGGG + Intronic
938585252 2:132684320-132684342 TAATCTGTAAAGAAGGTCCAGGG + Intronic
943801721 2:192068284-192068306 GGTTCTTTGAAGGAAGTCCACGG + Intronic
946044219 2:216807816-216807838 TGTTCTCAAAATGAGGCCCCAGG - Intergenic
948294856 2:236853071-236853093 CGTTCTCCAAAGGAGATCCGTGG - Intergenic
1170987216 20:21269333-21269355 TGTCCTTTTAAGGAGGGCCATGG + Intergenic
1171445164 20:25197450-25197472 TGTTCTTTAAAGGAGAGACAGGG - Intronic
1175470816 20:59226187-59226209 TGTTCTCTAAAGGAGAACTGAGG + Intronic
1178021582 21:28414538-28414560 TGTTCTCCATAGTAGCTCCATGG - Intergenic
1179150285 21:38803972-38803994 TATTCTGTAGAGGAGGCCCAAGG + Intergenic
1179156761 21:38857761-38857783 TGTTCTCACCAGCAGGTCCATGG + Intergenic
1179298341 21:40083034-40083056 TGTACCATAAAGGAGGTCCCAGG - Intronic
1179410939 21:41162745-41162767 TGTTCTTTAAAGGAAGTCCGAGG + Intergenic
1181968669 22:26673783-26673805 AGTTTTCTAAAGGAGGTGCCAGG + Intergenic
949460431 3:4286932-4286954 TGTTCTCAAAGTGTGGTCCAGGG + Intronic
952678552 3:36063614-36063636 TGTTCTCAAAAGTAGGTGAAAGG - Intergenic
956415793 3:69027607-69027629 TGTTCTTCAAATGAGGCCCAGGG - Intronic
957415177 3:79892765-79892787 TGTTGTCTAAAGAAGGTTTATGG + Intergenic
957840043 3:85655888-85655910 AGTTCTCAAAATGAGGTCCTTGG - Intronic
959130739 3:102353226-102353248 TGTTCTCAAAATGTGGTCCCTGG - Intronic
961071903 3:123939077-123939099 TGTTTTTTAAAGGAGTTCAAGGG + Intronic
963270367 3:143280238-143280260 TGTTCCCTAAAAGAGCTGCAGGG - Intronic
963330016 3:143903778-143903800 GTTTCTCTAAAGCATGTCCATGG - Intergenic
966588589 3:181654184-181654206 TTTTCTTTAGAGGAGGTCAAAGG - Intergenic
969283271 4:6185755-6185777 GGTTCTCAAAATGAGGTCCTGGG - Intronic
969911728 4:10453883-10453905 TATTTTTTAAAGGAGGTCCCTGG + Intronic
971957016 4:33433914-33433936 AGTTGTCTAAAGGAGTTCTATGG - Intergenic
972638104 4:40902210-40902232 TGTACTTTAAAAGAGTTCCAAGG + Intronic
976887297 4:90001283-90001305 TGTTCTTGACAGGAGGTCTAGGG - Intergenic
983092719 4:163523813-163523835 TGGTATCTGAAGGAGGTCCTGGG + Intergenic
984948058 4:184985329-184985351 TGCTCTCTCAAGGATATCCAAGG - Intergenic
985758084 5:1731057-1731079 TGTCCTCTAGAGAAGGTCAATGG - Intergenic
994731362 5:103495397-103495419 TGTTCTCTATCAGAGCTCCACGG + Intergenic
995132450 5:108644755-108644777 TGTTCTGTAAAGGTGATCTAAGG + Intergenic
998277548 5:140771248-140771270 TGTTCTATATGAGAGGTCCATGG + Intergenic
999554553 5:152726226-152726248 TGTGCTTTCAAGGAGGTTCATGG + Intergenic
1000405795 5:160887169-160887191 TGGTATCCAAAGGAGGTCCTAGG - Intergenic
1001269408 5:170300258-170300280 TGTCTTCTAAATGAGCTCCATGG - Intergenic
1001437993 5:171715331-171715353 TGGTATCTAAAGGAGGTCTGGGG + Intergenic
1003304186 6:4911536-4911558 TGTTTGCTAAAGGGGGTCCTTGG + Intronic
1004942478 6:20574481-20574503 AGTCCTCTAAAGTAAGTCCAAGG - Intronic
1006579129 6:35066525-35066547 TGTTCTCCCAAGCAGGTCCTTGG - Intronic
1007043841 6:38751626-38751648 TGTTCTTTAAAGGATCTCTATGG - Intronic
1008178906 6:48303401-48303423 TGTTCCCTAAAGGAGGGAGAGGG - Intergenic
1008244764 6:49158238-49158260 TGTTCTCTAAAGCAGTTTCAAGG - Intergenic
1009371340 6:62906606-62906628 TGTTCCCCAAAGGTGGTCCCTGG - Intergenic
1010151783 6:72741208-72741230 TGTTCTGAAAAGAAGCTCCATGG + Intronic
1011480914 6:87792770-87792792 AGTTCTCAAAATGTGGTCCATGG + Intergenic
1013909892 6:115262564-115262586 TGTTCTATATATAAGGTCCAGGG - Intergenic
1017343803 6:153356620-153356642 TGTTTTTCAAAGGAGCTCCAGGG - Intergenic
1018034556 6:159871280-159871302 TGTTCTGTCAAGGAACTCCAAGG - Intergenic
1021648220 7:22807559-22807581 TTTTTTCTAAAGGAGTCCCAGGG - Intergenic
1022280546 7:28904630-28904652 TGTTCCCCAACAGAGGTCCACGG - Intergenic
1023117502 7:36876659-36876681 GGTTCTCTAAACGTGGTCCCTGG - Intronic
1027256092 7:76431597-76431619 TGATCTCTAAAGGATGGCCTTGG + Intronic
1030240806 7:107322000-107322022 TGTTCTCTTAATGAGTCCCAAGG - Intronic
1030898273 7:115088799-115088821 TGTACTCTCCAGAAGGTCCAAGG - Intergenic
1032143070 7:129351750-129351772 GGTTCTCAAAATGTGGTCCATGG + Intronic
1033248295 7:139736947-139736969 AGTTCTCAAAAGGTGGTCAAGGG + Intronic
1034072895 7:148204211-148204233 TGTTCTCTAAAGAAGGCAGAAGG + Intronic
1034231316 7:149530794-149530816 TGTTCTCTAAGGGAAGTCTCTGG + Intergenic
1035586957 8:783967-783989 TGATTTCTGAAGGAGTTCCAAGG + Intergenic
1037022587 8:13992246-13992268 TGCTATCTTAAGGAGGTTCAAGG - Intergenic
1037803137 8:22045781-22045803 TATTCTATGAAGGAGGTGCACGG - Intronic
1037845607 8:22279368-22279390 TGTTCTCTACAGCCCGTCCATGG + Exonic
1038966946 8:32584379-32584401 TGCACTCTTAAGCAGGTCCATGG - Intronic
1042248721 8:66734644-66734666 TGTTGTCAAAAGTAGGTGCAGGG + Intronic
1042978780 8:74501958-74501980 TTTTCTCTAAAGTAGGCCCCCGG - Intergenic
1044806396 8:96012684-96012706 TGTTCTTTAAAGGACCTCAAGGG + Intergenic
1046408698 8:113810628-113810650 TGGTATCTAAGGGAGGTCCTGGG - Intergenic
1053122496 9:35557434-35557456 TGTTCTCTGAAGCAGAACCAAGG + Intronic
1053306326 9:36986796-36986818 AGATCTTTGAAGGAGGTCCAGGG - Intronic
1053590547 9:39510022-39510044 TGTTCTTTAAAAGTGGTCAAAGG + Intergenic
1053848408 9:42265411-42265433 TGTTCTTTAAAAGTGGTCAAAGG + Intergenic
1054575755 9:66855267-66855289 TGTTCTTTAAAAGTGGTCAAAGG - Intergenic
1054710294 9:68504364-68504386 TCTTCTCTAAATGAGGTGGAGGG - Intronic
1055703695 9:78974506-78974528 TGTTCTCTAAAGGGGGAAAAAGG + Intergenic
1059502399 9:114766455-114766477 AGTTCTCAAATGGAGGTCCACGG - Intergenic
1061335997 9:129936495-129936517 TGTCCACAAAATGAGGTCCATGG - Intronic
1061569500 9:131468109-131468131 TGTCCTCTAAGGAACGTCCAAGG - Intronic
1188182816 X:27076288-27076310 TGTTTTCTAAACGAGCTTCATGG - Intergenic
1188604842 X:32015550-32015572 AGTTCTCAAAGGGAGGTCCCGGG - Intronic
1189593432 X:42539565-42539587 TCTACTCTAAAGGAGGGCCTGGG - Intergenic
1189871108 X:45383775-45383797 GGTTCTCAAAGGGTGGTCCATGG + Intergenic
1190196919 X:48327749-48327771 TGTTTTCTAAGGTAGGTGCATGG - Intergenic
1190199337 X:48346742-48346764 TGTTTTCTAAGGTAGGTGCATGG + Exonic
1190248929 X:48707852-48707874 TGGCCTATTAAGGAGGTCCAAGG + Exonic
1190576042 X:51839908-51839930 GGTTCTCAAAATGTGGTCCAGGG + Intronic
1190655017 X:52603952-52603974 TGTTTTCTAAGGTAGGTGCATGG - Intergenic
1190663658 X:52678111-52678133 TGTTTTCTAAGGTAGGTGCATGG - Intronic
1190666107 X:52697225-52697247 TGTTTTCTAAGGTAGGTGCATGG + Exonic
1190673311 X:52761185-52761207 TGTTTTCTAAGGTAGGTGCATGG - Exonic
1190675765 X:52780311-52780333 TGTTTTCTAAGGTAGGTGCATGG + Intronic
1192800489 X:74460620-74460642 TGTTTTCTAAAAGTGGCCCAAGG - Intronic
1194120231 X:89952646-89952668 TGTTTTTTAAAGGAGCTCAATGG + Intergenic
1194803467 X:98299813-98299835 TTCTCTCTGAAGGTGGTCCAAGG + Intergenic
1195462956 X:105147928-105147950 TGTTCTCTAATGGGGGTGGAGGG + Intronic
1196502237 X:116398565-116398587 AGTTCTCAAAATGTGGTCCAGGG + Intergenic
1197175137 X:123477650-123477672 TGTTCTCAAAGTGTGGTCCAGGG - Intronic
1197306195 X:124844864-124844886 GTTTCTCAAAATGAGGTCCATGG + Intronic
1200473093 Y:3610176-3610198 TGTTTTTTAAAGGAGCTCAATGG + Intergenic
1200969133 Y:9131429-9131451 TGTCCTCTAAAGGAAGTCTCTGG - Intergenic
1202141695 Y:21731070-21731092 TGTCCTCTAAAGGAAGTCTCTGG + Intergenic
1202145170 Y:21772732-21772754 TGTCCTCTAAAGGAAGTCTCTGG - Intergenic