ID: 1160211068

View in Genome Browser
Species Human (GRCh38)
Location 18:76880283-76880305
Sequence CATCACAGTGGGCATCAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160211062_1160211068 2 Left 1160211062 18:76880258-76880280 CCCCGCAGCCTGGGCAGCAGCTG 0: 1
1: 0
2: 5
3: 69
4: 538
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
1160211065_1160211068 -6 Left 1160211065 18:76880266-76880288 CCTGGGCAGCAGCTGAGCATCAC 0: 1
1: 0
2: 3
3: 37
4: 275
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
1160211059_1160211068 21 Left 1160211059 18:76880239-76880261 CCGGTGGAGTCGGGGCAGTCCCC 0: 1
1: 0
2: 3
3: 13
4: 111
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
1160211058_1160211068 27 Left 1160211058 18:76880233-76880255 CCGGCGCCGGTGGAGTCGGGGCA 0: 1
1: 0
2: 1
3: 16
4: 67
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
1160211063_1160211068 1 Left 1160211063 18:76880259-76880281 CCCGCAGCCTGGGCAGCAGCTGA 0: 1
1: 1
2: 7
3: 82
4: 700
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
1160211064_1160211068 0 Left 1160211064 18:76880260-76880282 CCGCAGCCTGGGCAGCAGCTGAG 0: 1
1: 2
2: 5
3: 217
4: 4960
Right 1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160211068 Original CRISPR CATCACAGTGGGCATCAACC AGG Exonic
900483057 1:2908687-2908709 CCTAGGAGTGGGCATCAACCAGG + Intergenic
903471385 1:23590150-23590172 CATCACAGTGTTCATCAAATGGG - Intronic
903627006 1:24738080-24738102 CAACATAGTGGGCAACAACTGGG - Intergenic
906245404 1:44269929-44269951 CAACACAGATGGCATCAACTGGG + Intronic
906289573 1:44610916-44610938 CATTACAGTGGCCATAAAACGGG - Intronic
909596355 1:77410977-77410999 CATCGCGGTCGGCATCAAACTGG - Exonic
915132323 1:153704200-153704222 CACCACATTGGGCATAAATCTGG + Intergenic
916024129 1:160819461-160819483 CAGCAGTGTGGGCATCACCCAGG + Intronic
921165679 1:212505213-212505235 CTTCCCAGTGGGCAGCAACTGGG - Intergenic
1062906588 10:1183681-1183703 CATCACAGTGGGCAGGGAGCAGG + Intronic
1063476203 10:6330995-6331017 GACCACAGTGGGCATCAAATGGG + Intergenic
1068091058 10:52432701-52432723 CATCACAGTGGGGATGGAGCAGG - Intergenic
1072861211 10:99007116-99007138 TAGCACTGTGGGGATCAACCTGG + Intronic
1073477891 10:103766276-103766298 CTTCACAGTGGGCTTCCCCCCGG - Intronic
1074202487 10:111250276-111250298 CACCACAGTTGGCACCAAACTGG - Intergenic
1074767277 10:116708525-116708547 CATTACAGTGGGCACCAAACAGG + Intronic
1076133582 10:128029783-128029805 CCCCACAGTGGGCATCACCAGGG + Intronic
1077703965 11:4466588-4466610 CATGACACTAGGCATCATCCTGG - Intergenic
1080230123 11:30011409-30011431 CATCACACTGGGCACTGACCTGG - Exonic
1080757568 11:35216786-35216808 CATCAGAGTGGACATCACCTAGG + Intronic
1086917735 11:92550314-92550336 CATCACAGTGAGCAGCTTCCTGG - Intronic
1089561014 11:119343095-119343117 CATCACCTTTGGCATCATCCAGG - Intronic
1089624566 11:119742967-119742989 CATCACGGAGGGAATCAAGCAGG - Intergenic
1089753654 11:120669908-120669930 CATCCCAGTGGGGATGAATCTGG - Intronic
1090487673 11:127128496-127128518 CATCATAGTGGGCACCTACTAGG + Intergenic
1093914721 12:24788721-24788743 CACCACAGTGGGCAACTCCCAGG + Intergenic
1094064964 12:26352304-26352326 CAGCACAGAGGGCATCACCACGG - Intronic
1094871246 12:34600351-34600373 ACCCTCAGTGGGCATCAACCAGG - Intergenic
1095293744 12:40505394-40505416 CAGGTCAGTGGGCCTCAACCAGG - Intronic
1095511829 12:42959436-42959458 CATCACACTGATCATCAATCAGG - Intergenic
1095722809 12:45419041-45419063 GATGAGAGTGGGCATCAAGCAGG + Intronic
1098182517 12:67862995-67863017 CATTACTGTGGGCATGAACTTGG - Intergenic
1100635730 12:96433030-96433052 CATCACAGTGTGTATCTCCCAGG + Intergenic
1109267142 13:60214877-60214899 CATCCCAGTGCGCATGAATCAGG - Intergenic
1113392213 13:109908607-109908629 CATCACAGTGGCTCTCAACAGGG + Intergenic
1115322940 14:32104863-32104885 TAGCACAGTGGCTATCAACCAGG + Intronic
1121308875 14:92924023-92924045 CCCCACTGTGGGCAGCAACCAGG + Intronic
1121787759 14:96675312-96675334 CAGCACAGTGGTTCTCAACCAGG - Intergenic
1122598301 14:102908416-102908438 CAACACAGTGGGCAGCAGCCTGG + Exonic
1122647595 14:103205768-103205790 CGTGACAGTGGGCATGAACCTGG - Intergenic
1123983043 15:25621271-25621293 CATCATGGTGGGCACCAGCCAGG + Intergenic
1124595140 15:31086088-31086110 CTTCACAGTGGTCATAAACAAGG + Intronic
1127703549 15:61525469-61525491 GATCAGAGTTGGCCTCAACCTGG - Intergenic
1128127605 15:65204535-65204557 CATCACAGTCAGCATTCACCTGG + Exonic
1132698914 16:1213989-1214011 CAACACAGTGGGCACAACCCTGG + Intronic
1132756557 16:1488104-1488126 CATCGCAGTGGGGATCAAATCGG - Intronic
1132932515 16:2466167-2466189 CATGACAGTGGGGACAAACCTGG - Intergenic
1132999750 16:2842928-2842950 CATCACTGTGGGCAATAACTTGG + Intergenic
1137912065 16:52387764-52387786 CATGAAAGTGGGTAGCAACCAGG - Intergenic
1142219083 16:88844226-88844248 CATCACACCTGGCATCACCCCGG - Intronic
1143369065 17:6427039-6427061 AATCACTCGGGGCATCAACCTGG + Exonic
1143520771 17:7443068-7443090 CTTCACAGTGGCCATGTACCAGG + Exonic
1144057119 17:11553297-11553319 CATCACTGTGGGCATCCCCCAGG - Intronic
1146788978 17:35741062-35741084 CATCATCGTGGGCAACAAGCGGG + Exonic
1147993531 17:44349470-44349492 CAGAGCAGTGGGCATCAACCTGG - Exonic
1149772857 17:59334476-59334498 CATCACAATGGGAAGTAACCAGG - Intronic
1150443501 17:65210584-65210606 CAACACTGTGGACATCACCCAGG + Exonic
1152160450 17:78665220-78665242 AATCACACAGGGCATGAACCGGG + Intergenic
1152203645 17:78961763-78961785 CATCCCACTGGGCAGCAGCCTGG - Intergenic
1153326637 18:3827179-3827201 CATCCCTGTGGGCATACACCTGG + Intronic
1157015270 18:43704651-43704673 TATCACAGTGGGCATAATGCTGG - Intergenic
1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG + Exonic
1161518583 19:4710877-4710899 CACCCCAGTGGGCATGAACTTGG - Intronic
1165966963 19:39589976-39589998 AAATACAATGGGCATCAACCAGG - Intergenic
1167641778 19:50686532-50686554 CAGCCCAGTGGGCAGCACCCAGG + Intronic
1168063665 19:53907853-53907875 TATCACAGAGGGCACCAACGTGG + Intergenic
935180836 2:100690015-100690037 CACCACAGTGGCCATCCACAGGG - Intergenic
935755298 2:106271834-106271856 CCTCAATGTGGTCATCAACCTGG + Intergenic
935930988 2:108125264-108125286 CTCCACAGTGGGCTTCAAGCAGG + Intergenic
938427022 2:131201282-131201304 CAGAACAGTGGGCATGAGCCTGG + Intronic
938933873 2:136111748-136111770 AAACACAATGGTCATCAACCGGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
942123162 2:172798822-172798844 CATTACAATGGGTATCACCCAGG - Intronic
943958574 2:194227840-194227862 CATCAAAGTGGACTTCAACATGG + Intergenic
945606906 2:211944836-211944858 CATCACCATGAGCATCATCCAGG - Intronic
1169307873 20:4508760-4508782 CATCAGCGTGGTCATCAACCAGG + Intergenic
1172695446 20:36819570-36819592 CAGCACAGTGGTTCTCAACCTGG + Intronic
1176150920 20:63590334-63590356 CAGCACAGTGGAGATCCACCCGG - Exonic
1177110509 21:17021944-17021966 AATAACAGTGGGAATTAACCAGG + Intergenic
1178378595 21:32089734-32089756 CATCCCAGTGGGCTTGAACCTGG - Intergenic
1181908979 22:26222821-26222843 CATCACAGTGGTTCTTAACCAGG + Intronic
1182068690 22:27447956-27447978 CATCATAAAGGTCATCAACCTGG - Intergenic
1183421785 22:37715948-37715970 CATCACCATGGGAACCAACCTGG - Intronic
949517691 3:4821985-4822007 CTTCATAGTAGGCATCAGCCTGG - Intronic
951392281 3:22121074-22121096 ATTCACAGTAGGCAACAACCAGG - Intronic
951655470 3:25002444-25002466 CAACACACTGGGCATCATCCAGG + Intergenic
952944089 3:38465042-38465064 CATCACAGTTGAAACCAACCTGG + Intronic
952966445 3:38623835-38623857 CAGCACGGAGGGCATCTACCTGG - Intronic
953770206 3:45773931-45773953 CATCACAATGGGCACTAAGCAGG + Intronic
956309047 3:67858982-67859004 CATCACAGTAGACATCAGCCTGG + Intergenic
956906448 3:73770966-73770988 TGTCACAGTGGGCATCATCAGGG - Intergenic
961094918 3:124146052-124146074 GAGCACAGTGGGCATGACCCTGG + Intronic
961380301 3:126492441-126492463 CATCGCTGTGGCCATTAACCAGG - Exonic
970655742 4:18228544-18228566 CAACCCAGTGAGCATCACCCTGG - Intergenic
971340392 4:25763501-25763523 CATCGCAGTGGTCATGTACCTGG - Intronic
973124465 4:46567084-46567106 CATCACACTTGGCCCCAACCTGG + Intergenic
977342115 4:95771891-95771913 CATCTCAGTTAGCATGAACCCGG - Intergenic
977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG + Intronic
980009143 4:127576930-127576952 CAGCACAGTAGTCAACAACCTGG + Intergenic
982329182 4:154162209-154162231 CATCACAGTGGCCATCAGTCTGG + Intergenic
985712424 5:1436924-1436946 CCTCACAGGAGGCATCAAGCAGG + Intronic
986408097 5:7447369-7447391 CCTGGCAGTGGGCATCATCCTGG + Intronic
988847028 5:35137745-35137767 CATTTTAGTGGGAATCAACCAGG + Intronic
991267815 5:64743634-64743656 CATCTCTGTGGGCATGCACCAGG + Intronic
997942341 5:138169312-138169334 CATCACAGTGGGTAACCTCCGGG + Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001722153 5:173865786-173865808 CATCACAGTGCCCATGAAACAGG + Intergenic
1003313709 6:4992001-4992023 AAGCACAGTGGGCATCTGCCTGG - Intergenic
1008735594 6:54539887-54539909 CTTCACAGTAGTCATGAACCAGG - Intergenic
1010258011 6:73782379-73782401 TATTACAGTGGGCATCAAGAAGG - Intronic
1010315752 6:74448126-74448148 GAGCACAGTGGGCATCATCTTGG - Intergenic
1014641661 6:123918512-123918534 CAACACAGTAGCCACCAACCTGG - Intronic
1015272842 6:131355064-131355086 CATCAGAGTGGGCCTCAGTCAGG - Intergenic
1015903740 6:138095154-138095176 AATGAAAGTGGGCATCAACCAGG + Intronic
1017958345 6:159198965-159198987 CATCCCAGGGGGCATCAGCCAGG + Intronic
1019504417 7:1383726-1383748 CCTCCCTGTGGGCATCACCCTGG + Intergenic
1019596476 7:1860715-1860737 CATCATCCTGGGCATCACCCCGG + Intronic
1020626614 7:10589198-10589220 TATCACAGTGGTTTTCAACCAGG - Intergenic
1030836800 7:114297388-114297410 TATGACAGTGGGCCTCAACAAGG - Intronic
1036086884 8:5622118-5622140 CATATCAGTGGGCCTCATCCAGG + Intergenic
1039489075 8:37934367-37934389 CATCACTGAGGGCATCAATGAGG - Exonic
1039517764 8:38147710-38147732 CATCACAGGGGACAGTAACCAGG - Intronic
1040596427 8:48841831-48841853 CATAACAGTGTACCTCAACCTGG - Intergenic
1042257571 8:66821226-66821248 CATTAAAGTGGGTATCAACAAGG - Intronic
1043164401 8:76885368-76885390 CAACACAGTGAGCATCAATTTGG - Intergenic
1044959696 8:97518212-97518234 CATCCCAGTGGCTGTCAACCTGG + Intergenic
1047196901 8:122729815-122729837 CATCACAGTGGGCATTCAGAGGG + Intergenic
1047578020 8:126179736-126179758 CTTCACAGGTTGCATCAACCCGG - Intergenic
1048977590 8:139681636-139681658 CAGCACAGCGGGCAGCAAGCTGG + Intronic
1053144950 9:35705961-35705983 CATCACCCAGGCCATCAACCAGG - Exonic
1055278085 9:74642204-74642226 TCTCACTGTGGGCATAAACCAGG + Intronic
1059505012 9:114790658-114790680 CATCACTGTGGTCATCACCAAGG - Exonic
1060513456 9:124250772-124250794 CAGGACAGTAGGCATCACCCAGG + Intergenic
1188756482 X:33969327-33969349 CATCACAGATGGCAGCACCCTGG + Intergenic
1189033437 X:37472275-37472297 CATAACAGTGGAAACCAACCTGG - Intronic
1189517966 X:41734632-41734654 TATGACAGTGGGCCTTAACCAGG + Intronic
1192202390 X:69074879-69074901 CTGCACAGTGGGCATCACCTGGG - Intergenic
1192544959 X:72005579-72005601 CTCCACAGTGGCCCTCAACCAGG - Intergenic
1193286825 X:79723752-79723774 AATCCCAGTTGGGATCAACCTGG - Intergenic
1195426249 X:104734865-104734887 CATCCTAGTGGGCCTCAAACAGG + Intronic
1197283122 X:124561600-124561622 TAGCACAGTGGTAATCAACCTGG - Intronic
1197617931 X:128715332-128715354 CACCACAGTGGTCACCAAGCAGG + Intergenic
1200855491 Y:7933445-7933467 CATAACAGAGGCCACCAACCAGG - Intergenic
1201896640 Y:18999126-18999148 CATCGCAAAGGGCATCAAACAGG + Intergenic