ID: 1160213640

View in Genome Browser
Species Human (GRCh38)
Location 18:76906658-76906680
Sequence TGACCAATGCTGTAATTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160213634_1160213640 -5 Left 1160213634 18:76906640-76906662 CCTTGTTTCCGGACCCAGTGACC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1160213633_1160213640 -4 Left 1160213633 18:76906639-76906661 CCCTTGTTTCCGGACCCAGTGAC 0: 1
1: 0
2: 1
3: 2
4: 75
Right 1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160213640 Original CRISPR TGACCAATGCTGTAATTGCG GGG Intronic
901720786 1:11195577-11195599 TGACCCAGGCTGGACTTGCGGGG + Exonic
903537662 1:24077615-24077637 TGATAAATGCTGCAATTGAGGGG - Intronic
903651873 1:24927535-24927557 TTGCCAATGCTGAAATGGCGAGG + Intronic
905537196 1:38731603-38731625 TGACCACTTCTGTAATTGAGAGG - Intergenic
906859390 1:49342634-49342656 TGCCCAATGCTGTATTTCTGTGG + Intronic
907749517 1:57248897-57248919 TGACTAATGCTGCAACTGCAAGG - Intronic
910168104 1:84348980-84349002 TGCCCAATGTTGCAATTGTGAGG + Intronic
916798701 1:168192921-168192943 TGACAAATGCTATAATTGAGAGG - Intronic
917727976 1:177845786-177845808 TGACCTGTGCTGTAAGTGAGGGG + Intergenic
1066407504 10:35132677-35132699 AGACCAATGGTGTAATTTCATGG + Intronic
1071721842 10:88154389-88154411 TAACTAATACTGTAATTGAGAGG - Intergenic
1072338845 10:94426419-94426441 TGTCCATTGATGTAATTGTGTGG + Intronic
1072894442 10:99354605-99354627 TGATAAATGCTGTAATAGAGAGG + Intronic
1075309519 10:121401423-121401445 TGCCCAAGGGTGTAATTGCTAGG - Intergenic
1077998401 11:7473750-7473772 TGACCAATCCTGTGATTTCCAGG + Intergenic
1086943581 11:92822870-92822892 TTAACAATGCTGAAATTGCAAGG - Intronic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1092101965 12:5890841-5890863 TGACCAATCCTGTAAGTGAATGG - Intronic
1093081892 12:14821974-14821996 TGACCTCTGCTGTACTTGTGAGG + Intronic
1093357401 12:18183675-18183697 TGACCAATGCTTTGTTTGCTGGG + Intronic
1098293935 12:68985120-68985142 TGCCCAATGCTGTAGCTTCGTGG + Intergenic
1098353721 12:69589858-69589880 TCAACAATGCTGGAATAGCGCGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106151626 13:27109271-27109293 TGAGCAATGCTGAAATCGCTGGG - Intronic
1106559035 13:30833102-30833124 TGACTAATGTTGTTATTGCCTGG - Intergenic
1131638753 15:94266615-94266637 AGACCATTGCTGTAGTTGGGCGG + Intronic
1131758986 15:95599072-95599094 TGATGAATGCTGTGATTGTGTGG + Intergenic
1133850909 16:9502585-9502607 GGACCCATGCTGTAATTACATGG + Intergenic
1137678373 16:50315958-50315980 TGAGAAATGCTGTCATTGCCAGG - Exonic
1141312494 16:82928264-82928286 TGACCAGTCCTGTAATTGATGGG + Intronic
1142871323 17:2823063-2823085 TGAAAAATGCTGTAAATGGGTGG + Intronic
1144181734 17:12758537-12758559 TGAACAATGTGGTAAGTGCGAGG - Intronic
1149289395 17:55201555-55201577 TGAGAAATGCTGTAATTACTAGG - Intergenic
1151045892 17:70919292-70919314 TGACCAATGCTGTATTAGTCAGG + Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG + Intronic
1164091554 19:21957390-21957412 TTACCAAGGCTCTAATTGGGAGG + Intronic
1165966993 19:39590285-39590307 TGAGCAATGCTGTGTTTGCTGGG - Intergenic
927138621 2:20114891-20114913 TGGCCATTGCTGTAAGTGTGAGG - Intergenic
929815141 2:45224633-45224655 TGACAAAGGCTGTGATTGTGGGG + Intergenic
930483374 2:51978878-51978900 TGCCCAGTGGTGTAATTGCTTGG - Intergenic
931564236 2:63597576-63597598 TGACCAATGCTGTATTTTATGGG + Intronic
935819666 2:106882249-106882271 TGACAACTCCTGTAATTGTGTGG - Intronic
940853377 2:158709035-158709057 TGACCAAGGGTGCAATTGCTAGG + Intergenic
941727740 2:168882285-168882307 TGCCCAAAGCTGTATTTGCTAGG + Intronic
948291267 2:236826629-236826651 TGACCAAGGCTGTAAATTGGAGG + Intergenic
948320212 2:237062802-237062824 TGTGCCATGCTGTCATTGCGTGG - Intergenic
948913466 2:241018189-241018211 TGACCAAAGCTGCAAATGCGCGG - Intronic
1173178364 20:40782761-40782783 TGACCAAGACTGTAATTTCATGG + Intergenic
1177537903 21:22452627-22452649 TAACCAATTGTGTACTTGCGTGG + Intergenic
1181013174 22:20054031-20054053 TGGCCAATGCTGTTAGTCCGGGG + Intronic
952503917 3:33989921-33989943 TGTCCATTGCTGTAATTTCTGGG + Intergenic
955261238 3:57392926-57392948 TGACCAAGGCTGTAAATTAGTGG - Intronic
967846035 3:194043633-194043655 TGACCAATGTTCTAATTGCCTGG - Intergenic
969063949 4:4462242-4462264 TGACCTATGCTGCAGTTGCAGGG - Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
974272401 4:59667517-59667539 TGACCAACGCTGTTATTTCCAGG + Intergenic
977126482 4:93174980-93175002 TGTCCAATAGTGTAATTGCTGGG + Intronic
981258942 4:142696463-142696485 TGACCCAGGCTGTAATTCTGTGG + Intronic
985622052 5:960924-960946 TGTGCAATGCTGTAATGGAGGGG + Intergenic
995424932 5:112010490-112010512 TAAGGAATGCTGTAATTGCTGGG + Intergenic
995470233 5:112493874-112493896 TGACAAATGCTGTGATTGTATGG - Intergenic
995902766 5:117089680-117089702 TGATCAATGATGTAATTGGCAGG - Intergenic
996116401 5:119624812-119624834 TGCCCAATAATGTAATTGCTGGG + Intronic
1008160195 6:48067770-48067792 TGAACAAAGATGTAATTGCAGGG + Intronic
1027435111 7:78156236-78156258 TGACCTAGGCTGTAATTTGGTGG + Intronic
1028945609 7:96576049-96576071 TGACAAATGCTGTAATTCACAGG - Intronic
1033834932 7:145298883-145298905 TAAATAATGCTGTAATTGAGAGG - Intergenic
1033900260 7:146129995-146130017 TGGCCAATGTTGGAATTGTGAGG - Intronic
1036544963 8:9759111-9759133 TCACCATTGCTGTATTTGCTTGG + Intronic
1038751809 8:30303186-30303208 TGACAAATGCTGTAAAGGAGAGG - Intergenic
1039153953 8:34534589-34534611 TGACAAGTGCTGTAATGGGGTGG - Intergenic
1039475964 8:37839561-37839583 TGACCTCTGCTGTCTTTGCGGGG + Exonic
1040848259 8:51869471-51869493 TGACCAATGCTGAAATAGCATGG - Intronic
1043375743 8:79647459-79647481 TGACCTAGGCTGTATTTGGGGGG + Intronic
1046267919 8:111855988-111856010 TGTCCAATGTTGTAATTAAGGGG - Intergenic
1051564046 9:18476172-18476194 TTACTAATGCTGTTATTGCTTGG - Intronic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1194305534 X:92242634-92242656 TGTCCAAAGGTGTAATTGCTAGG + Intronic
1194771169 X:97907801-97907823 TCACAAATGCTTTAATTGCAGGG - Intergenic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1199414365 X:147563697-147563719 TGACCAAGACTGTAATTACTAGG - Intergenic
1201666241 Y:16459204-16459226 TGACCAATGTTGAAATTTAGAGG - Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic