ID: 1160218361

View in Genome Browser
Species Human (GRCh38)
Location 18:76953900-76953922
Sequence CCTCCCAAGCATGAGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160218361 Original CRISPR CCTCCCAAGCATGAGGAGTG TGG (reversed) Intronic
900576945 1:3387692-3387714 CCGCCCAGGCACGGGGAGTGAGG + Intronic
902489600 1:16771638-16771660 GCTCCCAAGCAAGAGGAGGCTGG - Intronic
902492890 1:16798139-16798161 CTTCCCAAGGATTAGGAGTAAGG - Intronic
903711288 1:25326650-25326672 CATTCCAAGCAAGAGGAGGGGGG + Intronic
903715660 1:25364779-25364801 CATTCCAAGCAAGAGGAGGGGGG - Intronic
904399052 1:30243809-30243831 CCTCCCCAGCATGTGGGCTGGGG - Intergenic
905249281 1:36637756-36637778 ACTTCCAAGCAGGAGGAGTGGGG + Intergenic
905262082 1:36726844-36726866 CATTCCAGGCATGAGGAATGAGG - Intergenic
905463913 1:38138854-38138876 CCTCCAAAGAATGAGGGGTTTGG - Intergenic
906561094 1:46757512-46757534 CCTGTTAAGCAGGAGGAGTGGGG - Intergenic
906802419 1:48749660-48749682 CCCCACAATCATGAGGGGTGCGG + Intronic
908001495 1:59684630-59684652 CCTGCCAAGTATGTGGGGTGAGG + Intronic
908009493 1:59761519-59761541 CTTCCCAACCAAGAGGAGTAAGG + Intronic
911854018 1:102854154-102854176 CCGCCCAAGGCTGAGGAGTGCGG + Intergenic
913610672 1:120506848-120506870 CCTCCTAAGCAACAGGAGTGAGG + Intergenic
913984127 1:143549966-143549988 CCTCCTAAGCAACAGGAGTGAGG - Intergenic
914580518 1:149015391-149015413 CCTCCTAAGCAACAGGAGTGAGG - Intronic
916451274 1:164922790-164922812 CCTCCAAAGAATGAGAAGTTAGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920054465 1:203182244-203182266 CCTCACAGGCATGAGGGGTGGGG + Intronic
920695924 1:208181272-208181294 CCTCCTAAGGCTGAGGAGGGTGG + Intronic
921430354 1:215058233-215058255 AGTCACAAACATGAGGAGTGAGG - Intronic
922109952 1:222547100-222547122 CCTCCCAGGCATGTGGATTTTGG + Intronic
922421470 1:225463493-225463515 CCTCCCAAGGAAGAGGAGGGAGG + Intergenic
923527559 1:234784391-234784413 CTTCCCAAGGATTAGGAGTAAGG + Intergenic
923530837 1:234810891-234810913 GCTCCCAAGCAAGAGGAGGCTGG + Intergenic
1063482843 10:6391508-6391530 CCTCCCCAGCATGCAGAGTCAGG - Intergenic
1069362021 10:67653776-67653798 CTTCCAAAGCATGAGGATAGGGG - Intronic
1070313684 10:75292098-75292120 ACTCCCTGGCATGAGGGGTGAGG + Intergenic
1071137423 10:82468266-82468288 CCTCCCTTGCATGAGAAGGGTGG + Intronic
1073495342 10:103885645-103885667 CCTCCCAAGCATTGGGATTATGG + Intronic
1075633440 10:124015102-124015124 CTTGCCAAGCAGGGGGAGTGTGG + Intronic
1075933409 10:126319237-126319259 CATCCCATACTTGAGGAGTGGGG - Intronic
1079522919 11:21350037-21350059 CCTCCCAAGCATGACTGCTGAGG - Intronic
1082761961 11:57136160-57136182 CCTCACTAGCTTGAGGTGTGTGG + Intergenic
1083661172 11:64252357-64252379 GGTCCCAAGCCTAAGGAGTGGGG - Intronic
1084219213 11:67667326-67667348 CCTCCCTGGCATGTGGAGTGTGG - Intronic
1088558032 11:111082829-111082851 CTTCCCATGCAGGAGGGGTGTGG - Intergenic
1088653146 11:111976303-111976325 CCTCCAAGGCAGGAGGACTGAGG + Intronic
1091685934 12:2562239-2562261 ACTCCCAAGCATGAGGAAAAAGG + Intronic
1094846476 12:34363600-34363622 CGCCCCATGCATGCGGAGTGGGG + Intergenic
1095159523 12:38900646-38900668 CCACAAAAGCATGAGGAGTTTGG + Intronic
1099176392 12:79427720-79427742 CATCCCAGGCATGAGGCATGAGG + Intronic
1099566883 12:84262162-84262184 TCCCCCAAGAATGGGGAGTGGGG - Intergenic
1102625031 12:114228070-114228092 AATCCCAAACATGAGGAGTCAGG + Intergenic
1104309374 12:127640571-127640593 CCTCCCAAGCAAGAAGAAAGTGG - Intergenic
1104771323 12:131366494-131366516 CCTCCCAGCCATGATGAATGGGG + Intergenic
1104939291 12:132387384-132387406 CTTCCCCCGAATGAGGAGTGGGG + Intergenic
1106356627 13:28989681-28989703 TCTCCCCAGCAGAAGGAGTGAGG - Intronic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1114514511 14:23289380-23289402 ACTGCCAAGAATCAGGAGTGGGG + Intronic
1115155786 14:30337402-30337424 CCTCCCAAAAATGAGGAATAAGG + Intergenic
1117451101 14:55850894-55850916 CTTCCTGAGCATGAGTAGTGTGG + Intergenic
1118714897 14:68552277-68552299 CCTCCCAGGCATTGGGATTGGGG + Intronic
1119148536 14:72337538-72337560 CCATCCAAACATGAGCAGTGAGG + Intronic
1119154885 14:72400884-72400906 GTTCCCAAGCAGGAGGAGTGAGG + Intronic
1121114377 14:91333041-91333063 CCTCCCAAGCTGGAGGAATATGG - Intronic
1121912724 14:97806658-97806680 CCTCCCAATCATGTGGACCGTGG + Intergenic
1124410863 15:29435395-29435417 ACTCCCAGGAATGAGCAGTGGGG + Intronic
1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG + Exonic
1126480807 15:49117914-49117936 CTTCCCAGGAAAGAGGAGTGTGG - Intronic
1128481714 15:68045700-68045722 CCCCCCAAGCCTGAGGGGGGAGG - Intergenic
1128650201 15:69406248-69406270 CTTCTCAAGCAAGGGGAGTGGGG - Exonic
1129362407 15:75032158-75032180 CCTCCCAAGTTTGAAGGGTGTGG - Intronic
1129451319 15:75652764-75652786 CCTCCCAGGCCTGTGGTGTGGGG + Intronic
1130416684 15:83701150-83701172 CTTCCCAAGCAGGGGGAGTGAGG + Intronic
1130512982 15:84604372-84604394 CCTTCCAAGGTAGAGGAGTGTGG + Intronic
1131181146 15:90240951-90240973 CCTCCCAACAATGAGGACTGGGG + Exonic
1134234849 16:12457405-12457427 CCTCCCAATCACTAAGAGTGGGG - Intronic
1135074296 16:19380173-19380195 CCACCCAAGAAGGTGGAGTGGGG + Intergenic
1137745335 16:50816279-50816301 CCTCCCAAGGATGAGCTGTCAGG + Intergenic
1140188616 16:72795963-72795985 CCTCCAAAGCAGGAGTACTGGGG - Exonic
1144035641 17:11363054-11363076 GCTCACAAGGATGAGGAATGAGG - Intronic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1146845816 17:36181610-36181632 CCACCCACGCATGAGGAGACAGG - Intronic
1146922979 17:36726187-36726209 CCTCTCAAGGCTGGGGAGTGCGG - Intergenic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1147611210 17:41802922-41802944 CTTCCCAAGCTTGAGCGGTGTGG + Exonic
1148088504 17:45008802-45008824 CCTCCCAAGGTTGAGGATTAAGG + Intergenic
1151318342 17:73337585-73337607 CTTCCCAAGGCTGGGGAGTGGGG - Exonic
1151976009 17:77483845-77483867 CCTCCCAGGGATGCCGAGTGAGG + Intronic
1153348552 18:4054024-4054046 CCTGACAATCATGAGGGGTGAGG + Intronic
1156445434 18:37233342-37233364 CCTCTGAAGCATGGAGAGTGGGG + Intergenic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1160399818 18:78602019-78602041 CAGCCCAGGCTTGAGGAGTGGGG - Intergenic
1160992794 19:1867024-1867046 CCTCCCAAGCCTGAGGGCTATGG + Intergenic
1164714081 19:30378969-30378991 AGTCCCAGGCATAAGGAGTGTGG + Intronic
1166033189 19:40148232-40148254 CCTTCCACGCATAGGGAGTGGGG + Intergenic
1166395022 19:42433342-42433364 ACTCCAAAGAATGAGGAGTAAGG + Intronic
1167974421 19:53213000-53213022 CCTCACAAGTATGATGAGTGTGG + Intergenic
1168138733 19:54370182-54370204 CCTCCCAGGCAGGAAGGGTGGGG - Intronic
1168159295 19:54498315-54498337 CCTCCCAGGCAGGAAGGGTGGGG + Intronic
1168241069 19:55089150-55089172 CCTACTAAGAATGAGGGGTGGGG - Intergenic
926084013 2:10009901-10009923 CTTTCCAAGCAGGAGGAGGGAGG + Intergenic
929777706 2:44939039-44939061 CCACCCAAGCAGGCGGGGTGCGG + Intergenic
929866935 2:45725869-45725891 CCTCCCATGCATCATGAATGTGG - Intronic
930712725 2:54564362-54564384 TTTTCCAAGAATGAGGAGTGAGG - Intronic
934764960 2:96875504-96875526 ACTCCCCAGCCTCAGGAGTGGGG - Intergenic
935553080 2:104479023-104479045 TCTCCCCAACATGAGCAGTGTGG + Intergenic
939148458 2:138444695-138444717 GCTCCCAAGCAGAAGGAGAGAGG - Intergenic
940151600 2:150608445-150608467 CTTCACAAGCATGAAGAGTAAGG + Intergenic
943720390 2:191198088-191198110 CCAGCCAAGCATGAGGAGACAGG + Intergenic
944105403 2:196074158-196074180 CCTGTCAAGCAAGAGGAATGTGG + Intergenic
945081044 2:206086042-206086064 CCTGTCAAGCAAGAGGGGTGAGG + Exonic
945869207 2:215208236-215208258 CCACCCAAGGGTGAGGAGTGCGG + Intergenic
946301742 2:218828201-218828223 CCCCCCAGGCCTGAGAAGTGGGG + Intronic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
946523811 2:220496281-220496303 CTTCGCCAGCATGAGGGGTGTGG + Intergenic
947060309 2:226157051-226157073 CCACCCTAGCAGCAGGAGTGTGG - Intergenic
947491199 2:230595790-230595812 CCTTCCAAGCCAGAAGAGTGGGG + Intergenic
948711575 2:239828783-239828805 CCTTCCATGCTTGAGGGGTGGGG - Intergenic
1168965693 20:1896566-1896588 CCTCCCACCCTTGAGGAGGGAGG + Intronic
1170850795 20:20002852-20002874 CCTTCCAAGCATGGGGAGTATGG - Intergenic
1171210048 20:23309920-23309942 CTTACCAGGCATGAGAAGTGGGG - Intergenic
1172303739 20:33866917-33866939 CCCTCTAAGCAAGAGGAGTGGGG + Intergenic
1172502782 20:35438725-35438747 CCCCAGAAGCATGGGGAGTGTGG + Intronic
1172943231 20:38668825-38668847 ACTCCCAAGCATGAAGCGGGTGG - Intergenic
1173146042 20:40525150-40525172 CCTCCTAAGGAAGTGGAGTGGGG - Intergenic
1173650850 20:44663128-44663150 CCTTCAAAGCAAGAGGAGGGAGG + Intergenic
1173889750 20:46497219-46497241 TGCCCCAAGCATGAGGAGTGGGG + Intergenic
1175475882 20:59273982-59274004 ACTCCCACGCATGAGGACTCCGG - Intergenic
1175821912 20:61914590-61914612 CCTCCCAGGCCTGAGGGATGGGG - Intronic
1175822766 20:61919364-61919386 GGCCCCAAGCATGGGGAGTGGGG + Intronic
1175900789 20:62359185-62359207 CCTCCCTCAGATGAGGAGTGAGG - Intronic
1179506838 21:41846853-41846875 CTTCCCAACCAGGAGGAGTGAGG + Intronic
1179808539 21:43855320-43855342 CTTCCCAGGCAGGAGGGGTGTGG + Intergenic
1179979128 21:44887403-44887425 CCTCCTGAGCATGGGGACTGTGG + Intronic
1180069664 21:45430048-45430070 CCTCTCCAGCATGTGAAGTGGGG + Intronic
1180134933 21:45856154-45856176 CCTCCCAATCCTGAGGAGCCTGG + Intronic
1180834432 22:18922775-18922797 CCTCACAAGCCACAGGAGTGGGG + Intronic
1180925341 22:19549869-19549891 GCTGCCAAGCAATAGGAGTGCGG - Intergenic
1181065376 22:20303326-20303348 CCTCACAAGCCACAGGAGTGGGG - Intergenic
1181596722 22:23920031-23920053 CCGCTCAAGAATGAGGGGTGGGG + Intergenic
1181762786 22:25069493-25069515 CCAGCCCAGCATGGGGAGTGGGG - Intronic
1183263333 22:36810460-36810482 CCTCAAAAGCATGAAGTGTGGGG + Intronic
1183755090 22:39754471-39754493 CCTGCCAAGCCTGAGGGATGTGG - Intronic
1203284521 22_KI270734v1_random:148074-148096 CCTCACAAGCCACAGGAGTGGGG + Intergenic
953381942 3:42478649-42478671 CTTCCCATGCATTAGGGGTGGGG - Intergenic
954073136 3:48157834-48157856 CCACCCAAGGGTGAGGAGAGGGG - Exonic
954227447 3:49191444-49191466 CCTCCCAAGCTTTTGGAGTTTGG - Intronic
954576603 3:51679827-51679849 CCTCCCGAGCCTGAAGAATGAGG + Intronic
956327678 3:68071386-68071408 CCTCCCAAACATGAGAATTGTGG + Intronic
957268950 3:78003661-78003683 CCTCCCTAGGCTGAGGGGTGGGG + Intergenic
957630162 3:82707610-82707632 CCTCCCTTGGCTGAGGAGTGGGG + Intergenic
959728773 3:109575782-109575804 CAGCCCTAGGATGAGGAGTGAGG - Intergenic
960050398 3:113233811-113233833 CCTTCCAAGCATGGGGTGGGTGG - Intronic
960072426 3:113446231-113446253 CCACCCAAGCACAAGGACTGGGG + Intronic
960573878 3:119210624-119210646 CTTCCCAACCATGATGAGGGAGG + Intergenic
966899212 3:184468190-184468212 CTTTCCCAGCAAGAGGAGTGAGG + Intronic
967991994 3:195138450-195138472 TCCTCCAAGCCTGAGGAGTGAGG + Intronic
968504275 4:964706-964728 CCTCCCGGGCAGGGGGAGTGAGG + Intronic
968933900 4:3600012-3600034 CCTCCCCAGCCTGTGGAGAGGGG - Intergenic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
969651419 4:8470357-8470379 CCTCCCAAGCTGCAGGAGAGCGG - Intronic
970497229 4:16638757-16638779 CCTCGAAAGCAGGAAGAGTGAGG - Intronic
973064493 4:45771545-45771567 CATCCCAAGCATGGGAAGTGTGG - Intergenic
981267069 4:142798536-142798558 CCCCCCAAACATGAGGAATAAGG + Intronic
985085849 4:186311771-186311793 CCGACCACGCATGTGGAGTGGGG - Intergenic
986052803 5:4105545-4105567 CCTCCCAGGCAGGAGCAGTGGGG + Intergenic
987104001 5:14618949-14618971 CATTCCAGGGATGAGGAGTGGGG - Intergenic
994125025 5:96159283-96159305 CCATCCCAGCATGAGGAGGGAGG - Intergenic
995434240 5:112118155-112118177 CCTACCAAGCAGGAACAGTGAGG - Intergenic
1001403931 5:171462439-171462461 CCTCCCCAGCAGCAGGATTGGGG + Intergenic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1002569516 5:180132205-180132227 CCTCCCAACTATGATCAGTGCGG - Intronic
1003163731 6:3658157-3658179 GCACCAAAGCATGAAGAGTGTGG + Intergenic
1005603732 6:27454284-27454306 CACCGCAAGCATGAGCAGTGCGG + Intronic
1007473631 6:42105707-42105729 CCTCCCAGGCAAGGGGAGAGGGG - Exonic
1007697040 6:43740560-43740582 CCTCCCAAGGCAGTGGAGTGGGG + Intergenic
1011061946 6:83279940-83279962 CCACACAAGCAAGAAGAGTGTGG + Intronic
1016237987 6:141890976-141890998 CCTGCCAAGGATGAGTAGAGTGG - Intergenic
1019623452 7:2003599-2003621 CCTCCCAAGCCTCTGGTGTGGGG + Intronic
1020513438 7:9088507-9088529 CCTCCCATACAGGAAGAGTGAGG + Intergenic
1022248348 7:28583043-28583065 GCTGCCAAGCATGAGGGGTGTGG + Intronic
1023869802 7:44257114-44257136 ATTCCCAAGCAAGGGGAGTGGGG + Intronic
1023872464 7:44270177-44270199 CCTCCCAGGCATGAGGAAATGGG - Intronic
1025610391 7:63072095-63072117 CCTCCCAAGCCTGAGGATCCTGG + Intergenic
1025624243 7:63205264-63205286 CCTCCCACACATGATGTGTGTGG + Intergenic
1025956607 7:66187924-66187946 CCTCCAAACCTGGAGGAGTGTGG + Intergenic
1026095521 7:67343417-67343439 CATGCTGAGCATGAGGAGTGAGG - Intergenic
1026901082 7:74037888-74037910 CCTCCCAAGGATGAGTAGGCCGG + Intronic
1027269743 7:76512969-76512991 CCTCCCATGGATGTGGAGTGGGG - Intronic
1027320455 7:77006864-77006886 CCTCCCATGGATGTGGAGTGGGG - Intergenic
1029789930 7:102831659-102831681 GCTCCCAAGCTTGAAGATTGTGG + Intronic
1032079258 7:128850497-128850519 GCTCCCAGGCATGAGGGCTGAGG + Intronic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1034345233 7:150381800-150381822 CCTCCCCAGATTGAGGACTGGGG + Intronic
1034917946 7:155056396-155056418 CTTCGCAACCATGAGGACTGAGG + Intergenic
1035328341 7:158079778-158079800 ACTCCCACGCAAGAGGAATGGGG - Intronic
1035560144 8:598204-598226 CCACCCACGCATGAGGTGTGTGG - Intergenic
1035682602 8:1499105-1499127 CACTCCAAGAATGAGGAGTGGGG - Intergenic
1038018061 8:23531227-23531249 TCTGCCAAGCATGAGGAGTCAGG + Intronic
1038169332 8:25114625-25114647 CCTCTGAAGGATGAGGTGTGTGG - Intergenic
1041399253 8:57424388-57424410 CCCCCCAAGGATGAGGGCTGGGG + Intergenic
1044028468 8:87204084-87204106 CCTTTGAAGGATGAGGAGTGTGG + Intronic
1047311543 8:123696644-123696666 CCTCCCACCCAGGAGCAGTGAGG - Intronic
1049365124 8:142233368-142233390 CTTCCCCAGCACGAAGAGTGGGG - Intronic
1049408880 8:142463710-142463732 CCACCCAAGCCTGAGCAGGGAGG - Intronic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1050896284 9:10888300-10888322 CTTCCTAAGCATGATTAGTGTGG + Intergenic
1053228913 9:36388609-36388631 CACACCAAGCATGAGGAGTTGGG - Intronic
1056789172 9:89614712-89614734 CCTCCCCTGCATGGGGACTGTGG - Intergenic
1057395628 9:94677331-94677353 CATCCCAAACACGAGCAGTGAGG + Intergenic
1058216556 9:102240975-102240997 CCTCCTGAGCATGCTGAGTGAGG + Intergenic
1058626836 9:106942289-106942311 CCTCCCAACCCAGAGGAGGGAGG + Intronic
1060806801 9:126582823-126582845 CTTCCCAAGGATGAGGTTTGTGG - Intergenic
1061169461 9:128943849-128943871 CCTCCCAAGCTTGGGGAGAAAGG + Intronic
1061366344 9:130173905-130173927 TGTTCCAAGCATGAGGGGTGAGG - Intronic
1061571295 9:131478942-131478964 CCACTCAGGAATGAGGAGTGGGG - Intronic
1062351986 9:136143803-136143825 CTTCCCAAGTGTGAGCAGTGGGG - Intergenic
1186616885 X:11198138-11198160 CCTTCCAAAAATGAGGAGTGGGG - Intronic
1186791688 X:13005719-13005741 CCTGCCAGGAATGAGGTGTGGGG - Intergenic
1190622983 X:52306855-52306877 CTTCCCAAGTTTTAGGAGTGGGG + Intergenic
1190877214 X:54468563-54468585 CCTGCCCAGCGTTAGGAGTGAGG + Intronic
1192243781 X:69357001-69357023 CCTTCTATGCATGAGGAGAGGGG + Intergenic
1195991327 X:110685376-110685398 CCTCCCAAGTAGGAGTAGTTGGG + Intronic
1200276273 X:154735942-154735964 CCTCCCATGATTAAGGAGTGGGG + Intronic
1201529349 Y:14975242-14975264 CATCCCCAGGCTGAGGAGTGAGG + Intergenic
1201568853 Y:15393064-15393086 CCTCCCAACCCTGAAGAGTGAGG + Intergenic