ID: 1160224569

View in Genome Browser
Species Human (GRCh38)
Location 18:77002129-77002151
Sequence CTCCATGTGGAGTTGCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160224566_1160224569 5 Left 1160224566 18:77002101-77002123 CCTGATGGGATGGAGCACAGGAA 0: 1
1: 0
2: 3
3: 26
4: 288
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76
1160224564_1160224569 8 Left 1160224564 18:77002098-77002120 CCACCTGATGGGATGGAGCACAG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76
1160224561_1160224569 16 Left 1160224561 18:77002090-77002112 CCATTTTCCCACCTGATGGGATG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76
1160224559_1160224569 18 Left 1160224559 18:77002088-77002110 CCCCATTTTCCCACCTGATGGGA 0: 1
1: 0
2: 2
3: 18
4: 178
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76
1160224560_1160224569 17 Left 1160224560 18:77002089-77002111 CCCATTTTCCCACCTGATGGGAT 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76
1160224563_1160224569 9 Left 1160224563 18:77002097-77002119 CCCACCTGATGGGATGGAGCACA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160224569 Original CRISPR CTCCATGTGGAGTTGCCGCC TGG Intronic
900364564 1:2305814-2305836 CCCCATCCGGAGTTTCCGCCAGG - Intronic
900413678 1:2525471-2525493 CTCCAGGTGAAGCTGCCCCCAGG + Intronic
900596109 1:3480884-3480906 GTCCAGGTGGAGTTGCCCCCTGG - Exonic
901414243 1:9105847-9105869 CTCCATGTGGAGGTGGGGACTGG - Intronic
906298232 1:44662246-44662268 CTCCAGGCTGAGTTGCAGCCAGG - Intronic
914974896 1:152352283-152352305 CTCCATGTTGAGATCCAGCCTGG + Exonic
915311829 1:155008949-155008971 GGCCAGGAGGAGTTGCCGCCAGG + Intronic
920020511 1:202952303-202952325 CTCCATGTGCAGTTGTTACCTGG - Intronic
1067153217 10:43753383-43753405 CACCATTTGGAGTTGCTGCCGGG - Intergenic
1071802274 10:89076848-89076870 CCCCATGAGGAGATGCAGCCTGG + Intergenic
1072674386 10:97454535-97454557 GTCCATGTGGTGATGCCGCTGGG + Intronic
1075001063 10:118798263-118798285 CTCTATGTGGTGTTGCCTCAGGG - Intergenic
1076129260 10:128001642-128001664 CTCTATGAGGAGTTTCCTCCAGG - Intronic
1076717481 10:132373768-132373790 CTCCCTGTGGAGACCCCGCCAGG - Intronic
1079128843 11:17735929-17735951 CGCCAGGGGGAGTTGGCGCCGGG - Exonic
1082634846 11:55583466-55583488 TTCCATGTGGAGCTGCGGCCCGG - Intergenic
1083751608 11:64763924-64763946 ATCCATGTGGAGTCTCCACCAGG - Intergenic
1083775233 11:64891392-64891414 CTCCATGTGGAAGTGCCCACTGG - Intergenic
1087635888 11:100700589-100700611 CTCCATGTGCAATTGACTCCTGG - Intronic
1092545563 12:9448572-9448594 CTCCGTGTGGAGGAGCCGCTGGG - Intergenic
1094507390 12:31073479-31073501 CTCCGTGTGGAGGAGCCGCTGGG + Intergenic
1095765646 12:45891810-45891832 CTCCATGTTCAGTTGCTGCATGG - Exonic
1099928550 12:89047381-89047403 CTACATATGGAGTTGCTGCTAGG - Intergenic
1103063522 12:117877935-117877957 CTGCATGGGGCTTTGCCGCCCGG + Intronic
1108021970 13:46136876-46136898 CTTCATCAGGAGTTGCAGCCCGG + Intronic
1113229384 13:108195557-108195579 CATCATGTGGGGTGGCCGCCTGG - Intergenic
1113354461 13:109565339-109565361 CTCAAGATGGAGTTGCCGGCTGG - Intergenic
1118837004 14:69484720-69484742 CTCCCCGCGGAGTTCCCGCCCGG + Intronic
1129697793 15:77750445-77750467 CTCCATGTGGAGCTGGGGACTGG - Intronic
1132615683 16:840225-840247 CTCCCTGTGGAGGGGCAGCCTGG + Intergenic
1133315050 16:4877666-4877688 CCCCACTTGGAGCTGCCGCCAGG + Intronic
1136085784 16:27884000-27884022 CTCCACGTGGAGATGCTGCATGG - Intronic
1145398333 17:22512774-22512796 GTCCCTGTGGTGTTGCCCCCAGG - Intergenic
1151947224 17:77326239-77326261 CTCCCTGTGGACTTGGCGCTGGG + Intronic
1152472577 17:80498669-80498691 CTTCATGTGGCGTTTCCACCTGG + Intergenic
1152636653 17:81432939-81432961 CTCCCTGTGGGGTTGGTGCCTGG + Intronic
1152758902 17:82098278-82098300 GCCCATGTGGCGTGGCCGCCCGG - Exonic
1157608053 18:48938692-48938714 CTCCATCTGGAGTTTCTGTCTGG - Intronic
1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG + Intronic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1163148779 19:15399246-15399268 CTCGCTGTGGGGCTGCCGCCAGG - Intronic
1166998821 19:46732924-46732946 CTCCAGGAGGAGGGGCCGCCAGG + Intronic
1168272698 19:55258653-55258675 CGCCGGGTGGAGTTGCCGACGGG + Exonic
925012425 2:495977-495999 CTCCATGTGGAGTGGCCTCTGGG - Intergenic
926829316 2:16943368-16943390 CTCCCTGTGGAGCTACTGCCTGG - Intergenic
927936237 2:27078427-27078449 AGAAATGTGGAGTTGCCGCCGGG - Intergenic
931942360 2:67266604-67266626 CTCCTTGTGGATTTGAAGCCTGG - Intergenic
932748359 2:74354251-74354273 ATCCATGTTGACTTGCTGCCTGG + Intronic
937459417 2:122072955-122072977 CTCCCTGTGGAGTTCTCACCTGG - Intergenic
939221190 2:139303364-139303386 CTCTAGGTGGACTTGCCTCCAGG + Intergenic
941162561 2:162052400-162052422 CACCATGTGGGGATGCTGCCTGG + Intronic
942149192 2:173057787-173057809 CACCATGTGGACTGGCAGCCTGG + Intergenic
1172781158 20:37437718-37437740 CTCCATGTGGAGTGGCCACCAGG + Intergenic
1174113559 20:48212428-48212450 CTCCATGGGGCGTTTCCTCCAGG + Intergenic
1175999073 20:62824134-62824156 CTCTGTGTGGAGTGGCCTCCTGG + Intronic
1175999126 20:62824310-62824332 CACCATGAGGAGTGGCCTCCCGG + Intronic
1178916047 21:36706100-36706122 CTGCATCTGGAGTTACCCCCAGG + Intronic
1184655843 22:45941741-45941763 TTCCATGGGGAGTTGGCCCCGGG - Intronic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
950705337 3:14776024-14776046 CTCCCTGTGGAGGTGCATCCAGG + Intergenic
952611721 3:35217183-35217205 CTCCTTCTGGAGTTTCTGCCTGG - Intergenic
953916915 3:46926216-46926238 CTCCAGGAGGAGGTGGCGCCTGG + Intronic
960421169 3:117447314-117447336 TTCCATTCGGAGTTGACGCCAGG + Intergenic
963047853 3:141116386-141116408 CTCCATGTGGTGGTGCCAGCTGG - Intronic
968128790 3:196179979-196180001 CTCCAGGTGGAGTTGGAGCTGGG - Intergenic
969038425 4:4274709-4274731 CTGCATGTGGATTTGCCACTGGG + Exonic
979314553 4:119246372-119246394 CTCCACGTGGTCTTGCCGCATGG - Intronic
982324986 4:154120982-154121004 CTCCAAGTCGAGTTGCCTGCAGG + Intergenic
985269711 4:188182446-188182468 CTCCATGTGGTGTTGTCACTTGG - Intergenic
990483845 5:56237893-56237915 CTGCAATTGGAGTTGCCACCTGG - Intergenic
991650491 5:68847649-68847671 CTCCATGTGCAGTTGCCTGCTGG - Intergenic
999439448 5:151590279-151590301 CTCAATCTGGAGCTGGCGCCTGG - Intergenic
1006736741 6:36279083-36279105 CTGCAGGTGTAGTTGCCCCCCGG + Intronic
1019076833 6:169394655-169394677 CTGTGTGTGGAGTTGCTGCCTGG - Intergenic
1028936957 7:96475675-96475697 CTACATGTGGAGGTGCCTCCAGG + Intergenic
1036446883 8:8829252-8829274 CTCCAGGTGGGGGTGCAGCCCGG - Intronic
1041076055 8:54171085-54171107 CTCCCTGTGCACCTGCCGCCTGG + Intergenic
1053887087 9:42651803-42651825 CTGGATGTAGAGTTGCCGCATGG + Intergenic
1054226107 9:62459253-62459275 CTGGATGTAGAGTTGCCGCATGG + Intergenic
1057363391 9:94396218-94396240 TTCAAAGTGGAGTTGGCGCCAGG + Intronic
1057659946 9:96991880-96991902 TTCAAAGTGGAGTTGGCGCCAGG - Intronic
1059954598 9:119502391-119502413 CTCCATGTGGAGATGCTACTTGG + Intronic
1060294579 9:122334532-122334554 CTCCATGAGTAGTGGCTGCCTGG - Intergenic
1060963621 9:127699258-127699280 CTCCACCCGGAGTTGCCGCCAGG + Intronic
1186502962 X:10066661-10066683 ATCCATGTGGAGGTGCATCCAGG + Intronic
1194501013 X:94680819-94680841 CCCCATGTGGAGGTGGAGCCTGG + Intergenic
1197548768 X:127861922-127861944 CTCCACTTAGAGCTGCCGCCTGG + Intergenic