ID: 1160226160

View in Genome Browser
Species Human (GRCh38)
Location 18:77012713-77012735
Sequence CACAGCACACTGACGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160226154_1160226160 0 Left 1160226154 18:77012690-77012712 CCAGGCCACAAAAATGCCGGCAA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1160226152_1160226160 12 Left 1160226152 18:77012678-77012700 CCAGCTGTGTCACCAGGCCACAA 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1160226151_1160226160 16 Left 1160226151 18:77012674-77012696 CCTGCCAGCTGTGTCACCAGGCC 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1160226155_1160226160 -5 Left 1160226155 18:77012695-77012717 CCACAAAAATGCCGGCAACACAG 0: 1
1: 0
2: 2
3: 18
4: 163
Right 1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160226160 Original CRISPR CACAGCACACTGACGTGGTG GGG Intronic
900632250 1:3643514-3643536 CACAGCACCCTCACGTGGGGTGG + Intronic
902620229 1:17646523-17646545 CATAGAACACTGGCATGGTGGGG + Intronic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
904620265 1:31770926-31770948 CACAGAACACTCACTTGGCGAGG - Intergenic
909034954 1:70586395-70586417 CTCAGCACACTGACTTGCTGTGG + Intergenic
913997180 1:143661082-143661104 CACAGCCCACTAACCTGGCGAGG - Intergenic
914505080 1:148281693-148281715 CACAGCTCACTAACCTGGGGAGG + Intergenic
914507484 1:148302455-148302477 CACAGCTCACTAACCTGGGGAGG - Intergenic
914980760 1:152412451-152412473 CACACCATACTTAAGTGGTGGGG - Intronic
918432577 1:184477309-184477331 CACAGCACACCAACATAGTGAGG + Intronic
918607809 1:186450444-186450466 CTCAGGAGACTGACGTGGTAAGG - Intronic
920437076 1:205953959-205953981 CTCAGAACAGTGAAGTGGTGGGG + Intergenic
1063040558 10:2333167-2333189 CACAGCTCACTGTCGTGCTCTGG + Intergenic
1068891152 10:62149347-62149369 CACAGGACACTGGCCGGGTGCGG + Intergenic
1069601589 10:69711441-69711463 CATAGCACACTGTGGTGGTCAGG + Intergenic
1070548340 10:77470309-77470331 CTCAGCAAACTGAGGAGGTGAGG + Intronic
1071948207 10:90672083-90672105 CACAGCACAGTAAAATGGTGGGG - Intergenic
1072518853 10:96212682-96212704 CAGAGGAAACTGATGTGGTGTGG + Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1074120894 10:110493972-110493994 CACAACACCCTCACATGGTGAGG - Intergenic
1076113683 10:127880631-127880653 TACACCACACTGACCTGATGAGG - Intronic
1076787346 10:132757860-132757882 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787387 10:132758012-132758034 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787510 10:132758404-132758426 CACAACACAGTGCCGTGGTGTGG + Intronic
1077166912 11:1146437-1146459 CACAGCACGCTCACGCCGTGCGG + Intergenic
1077237658 11:1489554-1489576 CAGACCACACTGAAGGGGTGGGG + Intronic
1080212680 11:29805282-29805304 CACAGCACTCTGAACTGGTTAGG + Intergenic
1083661390 11:64253007-64253029 GTCAGCACACTGAAGTGGGGAGG + Intronic
1084688629 11:70711905-70711927 CACAGCACACGGACCTCGTGGGG + Intronic
1084698620 11:70771344-70771366 ACCAGCACACAGAAGTGGTGGGG + Intronic
1085120538 11:73964721-73964743 CACAGGACACTGAAGAGGTTGGG + Intronic
1086416063 11:86589924-86589946 CACATCACAGTGATGGGGTGTGG + Intronic
1094036123 12:26074185-26074207 CACAGCACACGTATGTGGAGAGG - Intronic
1114494109 14:23120817-23120839 GAAAGCACAGTGACCTGGTGTGG + Intergenic
1122864860 14:104599108-104599130 CACAGCACACTGGGCTGGAGAGG - Intronic
1134443523 16:14313573-14313595 CACAGCATAGGGATGTGGTGAGG + Intergenic
1135976845 16:27114052-27114074 GACAGCACACTCAAGGGGTGGGG - Intergenic
1136069410 16:27778951-27778973 AACAGGACAATGACGGGGTGGGG + Exonic
1136365802 16:29808711-29808733 CAGAGCTCACAGACATGGTGAGG - Exonic
1142110867 16:88330505-88330527 CACAAAACAATGACGTGTTGTGG + Intergenic
1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG + Intronic
1142494307 17:298223-298245 CACCCCACACTGAGCTGGTGGGG - Intronic
1142962138 17:3557662-3557684 CACAGAAGACTCACCTGGTGAGG + Exonic
1143024054 17:3930545-3930567 CACAAAACACTGCCGTGGGGTGG + Intronic
1143267929 17:5654337-5654359 CTCTGGACACTGACGTGGAGGGG - Intergenic
1147333417 17:39712308-39712330 CATAGCACACTGAGGAGGTGGGG - Exonic
1148724543 17:49779357-49779379 CCCAGCATCCTGACATGGTGTGG + Intronic
1151333308 17:73423991-73424013 CACATCTCACAGACGTGGTCGGG - Exonic
1151756186 17:76076495-76076517 CACCGCACACAGAGGAGGTGGGG - Intronic
1152263267 17:79278555-79278577 CACAGCACACAGGCAGGGTGGGG - Intronic
1154082917 18:11275970-11275992 CACAGGCCACTGCCGTCGTGTGG - Intergenic
1157272992 18:46290818-46290840 CACAGCACACAGGCCTGGGGAGG + Intergenic
1157757729 18:50233522-50233544 CTTAGCACACTGATGTGGTGTGG - Intronic
1158350957 18:56563894-56563916 CACAGCACAAGGAGGTGGAGGGG + Intergenic
1159078094 18:63704002-63704024 AACAGCCCACTCACGTGGTAAGG - Intronic
1159423130 18:68248997-68249019 CACAGGGGACTGTCGTGGTGCGG - Intergenic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1160530866 18:79561687-79561709 AACGGCAGGCTGACGTGGTGTGG - Intergenic
1161572007 19:5035904-5035926 CACAGGAGACTGAGGTGGGGAGG + Intronic
1161794032 19:6376211-6376233 CCCAGCACCCTGACTTAGTGGGG - Intronic
1163481182 19:17557225-17557247 TGCAGCCCACTGAAGTGGTGTGG + Intronic
1163746519 19:19052040-19052062 GCCACCACACTGACGTGGTCAGG + Exonic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1167821515 19:51932585-51932607 GACAGCACACTGGCCTGGTGCGG - Intronic
926158140 2:10469421-10469443 GACAGCAGACTGATGGGGTGAGG + Intergenic
930414765 2:51077707-51077729 CACAACACAGTAACGAGGTGAGG + Intergenic
931118470 2:59190353-59190375 CACAGCACACAGACCTAGAGAGG - Intergenic
931777168 2:65550698-65550720 CACAGTCCACTGAGCTGGTGTGG - Intergenic
935216263 2:100977476-100977498 CAGAGCACACTGTGGTGGGGTGG + Intronic
937988216 2:127648114-127648136 CACAGTACTCTGACTTGGTCTGG - Exonic
938297794 2:130189220-130189242 CACACCGCACTGAGGGGGTGGGG + Intronic
938458973 2:131485448-131485470 CACACCGCACTGAGGGGGTGGGG - Intronic
948156682 2:235788825-235788847 AAAAGCACCCTAACGTGGTGTGG - Intronic
948379354 2:237542016-237542038 CTCATCACTCTGACCTGGTGTGG - Intronic
1172448471 20:35005398-35005420 CACAGCACACTGAGGACGAGGGG + Intronic
1172785457 20:37465422-37465444 CCCAGCACTCTGAGGGGGTGAGG - Intergenic
1178929834 21:36807703-36807725 CACAGAACAGGGTCGTGGTGAGG - Intronic
1184330076 22:43821689-43821711 CACACAACACTGAGGTGGGGCGG + Intergenic
950274068 3:11643371-11643393 CCCAGCACACTGAGGAGGAGTGG + Intronic
952215304 3:31272252-31272274 CACCCCACACTGAAGTGGGGAGG - Intergenic
952825112 3:37518239-37518261 CACAGCATACAGACGTCGGGAGG + Intronic
952902599 3:38120080-38120102 GACAGGTCACTGACCTGGTGGGG - Intronic
953402289 3:42635163-42635185 CATAGCAGACTGTCGTGGAGAGG + Intronic
954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG + Intronic
956779032 3:72589890-72589912 CAGAGTACACTGAAGTGGTGAGG + Intergenic
958124803 3:89342043-89342065 CGCAGCAAACTGTCTTGGTGGGG - Exonic
959584831 3:108016182-108016204 CACAGCACAATCAAGTGGTGGGG - Intergenic
959779532 3:110212212-110212234 CACATCACACTGTCCTGTTGAGG - Intergenic
966137338 3:176713814-176713836 CTAAGCACACTGATGTGGTGGGG - Intergenic
968955607 4:3717350-3717372 CCCATCACAATGACATGGTGGGG - Intergenic
969130845 4:4990153-4990175 CACAGCCTACTGAGGTTGTGTGG + Intergenic
979791343 4:124785106-124785128 CACAGGACACTGTCTTGCTGGGG + Intergenic
986093304 5:4532500-4532522 CACAGCACACTGTATTGGGGAGG - Intergenic
987133332 5:14879406-14879428 CACAGCCCACTGCAGTGGAGGGG + Intergenic
988375660 5:30432093-30432115 CACAGCATAAGGACGTGGTTAGG + Intergenic
997034946 5:130178538-130178560 CACAGCACCCGGCCGTGGTCTGG + Intronic
1001105167 5:168847027-168847049 CTCAGCAAACTGAAGTGGTGGGG + Intronic
1002114052 5:176943982-176944004 CACAGCACACTGATGCAATGAGG - Intronic
1003866060 6:10363877-10363899 CACAGCAAACAGACGTGCTGTGG + Intergenic
1006962148 6:37943823-37943845 CAAAGTAAACTGAAGTGGTGAGG + Intronic
1011830552 6:91365999-91366021 CAATGCACACTGAAGTGGGGAGG + Intergenic
1014183180 6:118407456-118407478 CAGAGAACACTGACGGGGGGAGG - Intergenic
1018853312 6:167657225-167657247 GACAGCTCACTGACATGGTTTGG + Intergenic
1020656896 7:10939459-10939481 TACAGCACATTGATGTGCTGAGG + Intronic
1021167449 7:17358973-17358995 CAAAGCAAACCCACGTGGTGAGG + Intergenic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1027165132 7:75828870-75828892 CACAGGACACTGACGGCCTGAGG + Intergenic
1027166007 7:75834865-75834887 CACAGGACACTGACGGCCTGAGG - Intergenic
1029246923 7:99208717-99208739 CACAGCCTACTGAGCTGGTGTGG - Intergenic
1030045767 7:105493973-105493995 CACAGCATACAGACTTGCTGTGG + Intronic
1035356501 7:158279004-158279026 TACAGCTCACAGACGTAGTGAGG + Intronic
1038208616 8:25493753-25493775 GACAGCATACTCACGTGGTAAGG + Intronic
1043472883 8:80578897-80578919 CACAGCGCACTCCCGGGGTGGGG - Intergenic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1045694407 8:104792510-104792532 CTAAGCACACTGATATGGTGTGG + Intronic
1047503012 8:125456620-125456642 CACTCCACACTCAGGTGGTGAGG + Intergenic
1047958791 8:129995936-129995958 CACAGCCAACTGGCGTGTTGGGG - Intronic
1049534208 8:143170557-143170579 CACAGCAGAGTGACGGGATGTGG + Intergenic
1056729108 9:89149165-89149187 CACCGCACACTGGTGTGGTAAGG + Intronic
1060408137 9:123382690-123382712 TTCAGCACACAGAAGTGGTGTGG - Intronic
1060496157 9:124120273-124120295 CTGAGCACACTCACGTGCTGTGG + Intergenic
1060667903 9:125443854-125443876 CACAGTAAACTGACTTGGGGTGG - Intronic
1062577787 9:137216637-137216659 CACAGCTCACTGTCAGGGTGGGG - Exonic
1188529008 X:31117380-31117402 CACAGTACACTGACGTGCAAGGG + Intronic
1192910241 X:75596408-75596430 CACAGAACAGTCAGGTGGTGAGG - Intergenic
1196812112 X:119636963-119636985 CTCAGCCCACTCAGGTGGTGTGG - Intronic
1198189742 X:134289994-134290016 CACAGCCCACTGATATGGTTTGG - Intergenic
1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG + Intergenic
1199613304 X:149635428-149635450 CACAGCACACTGGAGGAGTGTGG - Intergenic