ID: 1160227261

View in Genome Browser
Species Human (GRCh38)
Location 18:77020680-77020702
Sequence TCTGAAGGCTGGAATCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160227261_1160227267 8 Left 1160227261 18:77020680-77020702 CCACCAAGATTCCAGCCTTCAGA 0: 1
1: 0
2: 2
3: 15
4: 227
Right 1160227267 18:77020711-77020733 GCTGTTCTGCACAGACCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 176
1160227261_1160227269 26 Left 1160227261 18:77020680-77020702 CCACCAAGATTCCAGCCTTCAGA 0: 1
1: 0
2: 2
3: 15
4: 227
Right 1160227269 18:77020729-77020751 TGTGGTGCTCACAGCTGTTCCGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160227261 Original CRISPR TCTGAAGGCTGGAATCTTGG TGG (reversed) Intronic
903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG + Intergenic
904471353 1:30738424-30738446 TCTGAAGGATGAACTCCTGGTGG - Intronic
905703896 1:40040270-40040292 TCTGAGGGCGGGAATCCGGGCGG - Exonic
906110545 1:43319287-43319309 GCCGAAGTCTGCAATCTTGGAGG - Exonic
906287640 1:44598060-44598082 TCTGGAGGCCTGACTCTTGGAGG - Intronic
906681591 1:47729763-47729785 TCAGAAGTCTAGTATCTTGGTGG - Intergenic
906732105 1:48091697-48091719 TCTGATGTCTGGAAGCATGGTGG + Intergenic
907707140 1:56842329-56842351 TCTGAAGGCAGGAGACTTGATGG - Intergenic
907725982 1:57021166-57021188 TCTAAAAGTTGAAATCTTGGAGG + Intronic
909455523 1:75844871-75844893 TCTGAAGGCTGGGATCTGCAAGG + Intronic
910201193 1:84701287-84701309 TCTGAAGGCTTGATTCCTGATGG + Intergenic
911587180 1:99704637-99704659 TCTGCCTGCTAGAATCTTGGAGG - Intergenic
911775547 1:101806800-101806822 TCTGAAGGTTTGAGTTTTGGGGG - Intronic
915044228 1:152998566-152998588 TCTGAAACATGGAATCCTGGTGG + Intergenic
915800395 1:158785576-158785598 TCTTAAGACTGGAATCATGCAGG + Intergenic
918893853 1:190314541-190314563 TCTGAAAGCTGGACTAATGGGGG + Intronic
920278543 1:204826602-204826624 TCTGCAGGCTGGATTCTTTGAGG + Intergenic
921283060 1:213585994-213586016 CCTGAGGGCTGGTATCTGGGGGG - Intergenic
921914482 1:220592085-220592107 TCAGAAGGCAAGAATCATGGGGG - Intronic
923034192 1:230272720-230272742 TCTGAATGCTAGAATCTTTAGGG + Intronic
924743113 1:246809203-246809225 TCTGAAGGCTGGTCTCATGGTGG + Intergenic
1067946668 10:50693629-50693651 GCTGAAAGCAGGAATCTTAGCGG - Intergenic
1069620813 10:69836295-69836317 TCCCAGGGCTGGAATCCTGGAGG - Intronic
1069949435 10:72008892-72008914 GGTGAAGTCTGGAATCTGGGTGG + Exonic
1070603960 10:77885554-77885576 GCAGGAGGCTGGAATCTTTGGGG - Intronic
1070881975 10:79858622-79858644 GCTGAAAGCAGGAATCTTAGCGG - Intergenic
1071187902 10:83064628-83064650 TCTGAAGGCTGCTACCTTTGAGG - Intergenic
1071453688 10:85824697-85824719 TCAGAAGACTGGAAGGTTGGTGG - Intronic
1071648551 10:87374935-87374957 GCTGAAAGCAGGAATCTTAGCGG - Intergenic
1073857971 10:107699288-107699310 TCTGATTGCTGGAAAATTGGTGG - Intergenic
1075903900 10:126064413-126064435 TCTGAGGGCAGGAGTCATGGTGG + Intronic
1081781579 11:45716706-45716728 GCTGGAGGCCGGAGTCTTGGGGG - Intergenic
1081991274 11:47338924-47338946 TCTGAAGGCTGGGGTCTTGAGGG - Intronic
1082644264 11:55702134-55702156 TCTGAAGACTGGAATCATGATGG - Intergenic
1085412886 11:76302005-76302027 TCTGGAGGCTGGAAGCTGGAGGG - Intergenic
1085920420 11:80948541-80948563 CTTGAAAGCTGGAATGTTGGAGG - Intergenic
1087009811 11:93502347-93502369 TATGAAGCCTGGAAACTTGCTGG - Intronic
1087543456 11:99551045-99551067 TCTGATGGCAGGATTCTTGGAGG - Intronic
1088560756 11:111113405-111113427 GGTGAAGACTGGAGTCTTGGAGG - Intergenic
1090194688 11:124804688-124804710 ACTGGAGGCTGGAATCTTTCTGG - Intergenic
1091855569 12:3736629-3736651 ACTGAGGGCTGGAATCATGCAGG + Intronic
1093058865 12:14582188-14582210 TCTGAAGAGTGGCATCATGGAGG - Intergenic
1095049095 12:37541420-37541442 CCTGAAGACTGGACTCCTGGGGG + Intergenic
1095517880 12:43027183-43027205 TCTGAAGGCTGGAGTCCAGATGG - Intergenic
1096866814 12:54569340-54569362 TGTGCAGGCTGGGATCTTCGTGG + Exonic
1096880440 12:54664179-54664201 TTTGAAGGATGGACTCTTAGGGG + Intergenic
1096932736 12:55232350-55232372 TCAGAGTTCTGGAATCTTGGAGG + Intergenic
1097178373 12:57156598-57156620 TTTGAAGGCTGGGTTGTTGGGGG + Intronic
1097707800 12:62885602-62885624 GTAGAGGGCTGGAATCTTGGGGG + Intronic
1099034630 12:77570666-77570688 TCTGAAGGAAGTAATCATGGTGG + Intergenic
1104174171 12:126313360-126313382 GCGCAAGGCAGGAATCTTGGGGG + Intergenic
1104411912 12:128565301-128565323 TCTCAAGGCTGAAATCCAGGTGG - Intronic
1104620378 12:130307565-130307587 TCAGAAGTCTGAAATCTAGGAGG + Intergenic
1105206058 13:18225268-18225290 CCTGAAGGGTGGGATCTTTGAGG - Intergenic
1105748510 13:23399822-23399844 TCTCAAGGCTGGCATCTTCCTGG - Intronic
1106616183 13:31330245-31330267 CCTGAAGTCTGTAATCATGGTGG + Exonic
1106754344 13:32807363-32807385 TCTGAACACCAGAATCTTGGTGG + Intergenic
1107523508 13:41206323-41206345 TCTGCAGGCTGGAAAGTTGAAGG - Intergenic
1111653015 13:91116360-91116382 TCTGATGGCTGGATTGCTGGTGG - Intergenic
1111910717 13:94308907-94308929 TCTGAACACTGGAAAGTTGGGGG + Intronic
1112341806 13:98558580-98558602 TCTGAAGGCAGGAAGCTAGTTGG - Intronic
1116408321 14:44593593-44593615 ACTGAAGGCCTGAACCTTGGAGG - Intergenic
1117272527 14:54159474-54159496 TCTGAAGGATGGAGTATGGGAGG + Intergenic
1118112434 14:62736549-62736571 TCTCAAGGCTGGCATCTTCCTGG - Intronic
1119174689 14:72560430-72560452 CCTGAAGGCAGGAAACATGGGGG - Intronic
1120391730 14:83917250-83917272 TCTGAAGGCTGGAATTATAAGGG - Intergenic
1202849630 14_GL000225v1_random:8781-8803 TCTGAATACTGGACTCTGGGAGG - Intergenic
1202851634 14_GL000225v1_random:23759-23781 TCTGAATCCTGGACTCTGGGAGG - Intergenic
1202923008 14_KI270724v1_random:2517-2539 TCTGAATCCTGGACTCTGGGAGG + Intergenic
1124034253 15:26039436-26039458 TCTGGAGGCTGAAACCTGGGAGG - Intergenic
1124394764 15:29291478-29291500 TCTGAAGGCAGGAATGTGGATGG - Intronic
1126499653 15:49331184-49331206 TCTGAATGCTGGACAATTGGAGG - Intronic
1126961637 15:54003078-54003100 TCTGAAGGCCGCAATTTTTGTGG + Intergenic
1127387908 15:58482206-58482228 TCTCTAGGCTGGAAACTGGGTGG - Intronic
1127632450 15:60839870-60839892 TATGAAGGCTGGCATCTAGTAGG + Intronic
1128053926 15:64685740-64685762 TCTAGAGGCTGGAATGTCGGGGG - Exonic
1129391031 15:75221019-75221041 TTTGAAGGATGGCATCTGGGTGG + Intergenic
1129473278 15:75766858-75766880 TTTGAAGGATGGCATCTGGGTGG - Intergenic
1130193824 15:81760835-81760857 TTTGAACGCTGCAATCTTGGGGG - Intergenic
1135551575 16:23402312-23402334 TCTCAATGGTGGGATCTTGGAGG + Intronic
1135741008 16:24975185-24975207 TATGCAGGCTGGAAACTGGGGGG - Intronic
1135971579 16:27075702-27075724 ACTGAAGGCTGGAACCTTGGTGG - Intergenic
1136470982 16:30479982-30480004 CCCCAAGGCTGGAATCATGGTGG + Intronic
1136508816 16:30723396-30723418 TCTATTTGCTGGAATCTTGGAGG + Intronic
1137635362 16:49981384-49981406 TCTGAAGGCTAGAATTTTACAGG - Intergenic
1142882345 17:2891512-2891534 TCTGATGGATGCAAGCTTGGCGG - Intronic
1142971603 17:3615474-3615496 TGTGCAGGCTGGAATCCTGAAGG + Exonic
1143660529 17:8321970-8321992 TCTGCAGGCAGGAATTATGGAGG - Exonic
1143922917 17:10345084-10345106 TCTGAAGGCTTGCAGCCTGGGGG + Intronic
1146137999 17:30340134-30340156 TCTGGAGGCAGGAAGCTTTGGGG - Intergenic
1146247682 17:31304349-31304371 TCTCAAGGTTGGAATCTTCTTGG + Exonic
1148332114 17:46819194-46819216 TCGGGAGGCTGGAAGCTGGGAGG - Intronic
1148394880 17:47299857-47299879 TGTGAGGGCTGGAATTATGGAGG + Intronic
1150572364 17:66398263-66398285 TCTGTGGGCTGGAATCTTCATGG - Intronic
1157714231 18:49872151-49872173 TCTGAAGGTAAGATTCTTGGGGG - Exonic
1157881122 18:51321943-51321965 TCCTGAGTCTGGAATCTTGGAGG - Intergenic
1158467081 18:57700075-57700097 TCTGAATACTGAAATATTGGAGG - Intronic
1159522592 18:69545225-69545247 TCTGAAAGCTGGGAACTTGAAGG + Intronic
1159684355 18:71399204-71399226 TCAGAAGGCTGGAAGCCTTGTGG + Intergenic
1160227261 18:77020680-77020702 TCTGAAGGCTGGAATCTTGGTGG - Intronic
1161114180 19:2487847-2487869 TCTGAGGGCTGGGCTCTTGGCGG - Intergenic
1164836122 19:31356138-31356160 TTTGAATGCTGGAATCCTGAAGG + Intergenic
1165354016 19:35292566-35292588 CCTGCAGGCTGCAATCTGGGAGG + Intronic
1166014140 19:39967422-39967444 TCTGAAGCCTGGAAACAGGGAGG + Intergenic
1167307854 19:48719416-48719438 CCTGGAGTCTGGAATCTTGAAGG + Intronic
925688101 2:6493529-6493551 TGTGGAGGCTTGAATCTTGGTGG - Intergenic
927205105 2:20604014-20604036 TCTGAGGGCAGGGGTCTTGGAGG - Intronic
927556192 2:24034475-24034497 TCTGGAGGATAGAATTTTGGGGG - Intronic
929589738 2:43137137-43137159 TCTGAAGGCAGGAAGGTTGCGGG - Intergenic
930829462 2:55727263-55727285 TCAGGAGGCTGGAATCATTGGGG + Intergenic
935839026 2:107088297-107088319 TTTGAAGGCTGGAATTGGGGAGG + Intergenic
936508559 2:113127719-113127741 CCTGAAGGCTTGCATCTTGCTGG - Exonic
937149844 2:119679005-119679027 TCTGGGGGCGGGACTCTTGGGGG - Intergenic
937973472 2:127566990-127567012 TCTGAAGGAAGGAAGCTTTGGGG - Intronic
940333219 2:152498193-152498215 CCAGAAAGCAGGAATCTTGGAGG + Intronic
942093003 2:172512348-172512370 TCTGAAAGATGGACTCATGGTGG + Intergenic
945735733 2:213597987-213598009 TCTGAGGGCTGCTATCTTTGAGG + Intronic
948130292 2:235595571-235595593 AGTGAAGGCTGGATTTTTGGGGG + Intronic
1170979379 20:21196624-21196646 CCTGAAGTCTGGAAGCTTTGGGG + Intronic
1171524540 20:25798760-25798782 CCTGAAGACTGGACTCCTGGGGG - Intronic
1171543630 20:25984923-25984945 CCTGAAGACTGGACTCCTGGGGG + Intergenic
1171552287 20:26057123-26057145 CCTGAAGACTGGACTCCTGGGGG + Intergenic
1171793423 20:29548415-29548437 CCTGAAGACTGGACTCCTGGGGG + Intergenic
1171855037 20:30335964-30335986 CCTGAAGACTGGACTCCTGGGGG - Intergenic
1172629366 20:36367698-36367720 TCAGAATTCTTGAATCTTGGGGG + Intronic
1172879881 20:38192979-38193001 TCTGAAGGTTGAATTCATGGGGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1175138269 20:56841219-56841241 GCTGAAGTCAAGAATCTTGGTGG + Intergenic
1175238988 20:57532862-57532884 TCTGAAAGCAAGCATCTTGGGGG + Intergenic
1178207183 21:30482410-30482432 TCTGACAGCAGGAATCTTGTTGG - Intronic
1179035759 21:37757653-37757675 TCTCCAGGCTGGAATCTGTGAGG - Intronic
1180613067 22:17109838-17109860 TCTCAAAGCTGGGATCTGGGCGG - Exonic
1180759906 22:18193448-18193470 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1180770218 22:18377747-18377769 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1180775762 22:18431252-18431274 CCTGAAGGGTGGGATCTTTGAGG - Intergenic
1180776112 22:18484919-18484941 CCTGAAGGGTGGGATCTTTGAGG - Intergenic
1180828159 22:18880703-18880725 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1181071764 22:20347263-20347285 CCTGAAGGGTGGGATCTTTGAGG - Intergenic
1181194833 22:21176205-21176227 CCTGAAGGGTGGGATCTTTGAGG - Intergenic
1181214612 22:21316565-21316587 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1181525014 22:23477807-23477829 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1203232050 22_KI270731v1_random:118931-118953 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
1203278257 22_KI270734v1_random:106705-106727 CCTGAAGGGTGGGATCTTTGAGG + Intergenic
949152734 3:790331-790353 TCAGAAGGCTTGAACCTGGGAGG - Intergenic
952170452 3:30800631-30800653 TCAGTAGGCTAGGATCTTGGAGG + Intronic
952243764 3:31562629-31562651 GCTGTAGGCTGGCAACTTGGGGG + Intronic
952638940 3:35568102-35568124 TCTGAAGGCTGGACTATGGCTGG - Intergenic
952880729 3:37984741-37984763 TGGGAGGGCTGGAATCTTTGTGG - Intergenic
955200132 3:56844570-56844592 CCTGTTGGCTGGAATCCTGGTGG - Intronic
957347144 3:78976452-78976474 ACAGAAGGCTGGAATCCTGAGGG - Intronic
960578098 3:119246678-119246700 TGTGCAGGCTTGAATCTGGGGGG - Intergenic
961500390 3:127328456-127328478 TTTGTAGGCTGGAAAATTGGAGG + Intergenic
961606884 3:128102152-128102174 TCTCAAAGCTGGCATCTTGCAGG + Intronic
962428571 3:135298016-135298038 TCTGAAGGCTGGAAGTCTGAAGG + Intergenic
964219578 3:154327977-154327999 TCTGAAGCCTGCAACCTTGGAGG + Intergenic
964477342 3:157108988-157109010 CCTGAATGCTGGAGTCTTGCAGG + Intergenic
966793650 3:183695000-183695022 TCTGGAGGCTTGAACCTGGGAGG - Intergenic
968502502 4:957441-957463 TCCGAGGGCTGGAAGCTGGGAGG + Intronic
969038421 4:4274680-4274702 TTTGGAGGCTGGAACCTTGGTGG + Exonic
969500666 4:7550684-7550706 TATGAAGGCAGGAAACTTGATGG + Intronic
969808220 4:9627307-9627329 TCTGTTGCCTGGAAGCTTGGGGG - Intergenic
970081854 4:12296283-12296305 CCTGCACTCTGGAATCTTGGTGG + Intergenic
971441405 4:26691543-26691565 TCAGCAGGCTGTAATCTTGTTGG - Intronic
971540868 4:27814551-27814573 TTAGGAGGCTGGATTCTTGGAGG + Intergenic
971683028 4:29726109-29726131 TCTGGAGGCTCGAACCTGGGAGG - Intergenic
972425540 4:38929157-38929179 GCTGCAGGCTGTAATGTTGGGGG + Intronic
972679945 4:41295676-41295698 TCTGACCCCTGGAAACTTGGCGG + Intergenic
973903983 4:55507915-55507937 TCTGAAAACAGGAGTCTTGGTGG - Intronic
975295067 4:72725287-72725309 TATGAAGTCTGGTATCTTGTAGG - Intergenic
976770099 4:88642544-88642566 TCTGGAGGCTGGAAACTTCAAGG + Intronic
977661206 4:99588664-99588686 TCAGAAGGCTGGAAAATTTGAGG - Intronic
977665057 4:99636831-99636853 TCTCAACGTAGGAATCTTGGTGG - Exonic
981389465 4:144171656-144171678 TCTGATGCCTGGAATCTGTGAGG + Intergenic
981579157 4:146235198-146235220 TCTGAAGGCTGGATGCCTGGGGG - Intergenic
984074575 4:175159510-175159532 TCTGAAGGCTGCTACCTAGGAGG - Intergenic
986764694 5:10914208-10914230 CCTGAGGACTGGAATCCTGGGGG + Intergenic
990942857 5:61220775-61220797 CCAGAGGGCAGGAATCTTGGGGG + Intergenic
992460476 5:76954790-76954812 TCTGACGACTGGAATCGAGGAGG - Intronic
994117838 5:96081089-96081111 TCTGGAGCATGGAAGCTTGGGGG - Intergenic
994650668 5:102522873-102522895 TCTGAAGGATAGTATCTGGGTGG - Intergenic
996469741 5:123845596-123845618 TGTGAAAGCTGGAATCCTGTGGG + Intergenic
997468748 5:134104899-134104921 TCTGAAGGCTGCAGTCATGGGGG + Intergenic
997588874 5:135061016-135061038 TCTGTAGGTTTGAGTCTTGGGGG - Intronic
997882319 5:137601898-137601920 TCTTAAGGCTGTAATCCTGGTGG - Intergenic
999548883 5:152661809-152661831 TCTGGAGCCTGGATTCTTTGGGG - Intergenic
1001086879 5:168706991-168707013 TGGGAAGGCTGGAAGCTGGGCGG + Intronic
1001647788 5:173295129-173295151 TCTGAAGGCTGAGATCCTGGAGG + Intergenic
1001684052 5:173579367-173579389 TCTGAAGGCTGGAATGAGGCTGG + Intergenic
1003101050 6:3176878-3176900 TCTGAAGGCTGGGATGATGCAGG + Intergenic
1007128933 6:39451411-39451433 TCTGTAGGCTGGATTCTCAGAGG + Intronic
1007509949 6:42367208-42367230 TCTGAAGGCTGGAAAGGGGGAGG - Intronic
1010017421 6:71121577-71121599 TATGTAGGCCTGAATCTTGGGGG + Intergenic
1011171787 6:84512931-84512953 TCTGAAGGCAGGAATCACAGTGG - Intergenic
1012482196 6:99679632-99679654 TGTGGTTGCTGGAATCTTGGTGG + Intergenic
1012578542 6:100833788-100833810 TTTAAAGGCTGAAATCCTGGCGG + Intronic
1016063539 6:139655338-139655360 TCTGTGGGCTGAATTCTTGGAGG - Intergenic
1017591137 6:155979109-155979131 CCAGAAGACAGGAATCTTGGAGG - Intergenic
1018532415 6:164781712-164781734 TCGGAAGGCTTGAACCTGGGAGG + Intergenic
1018963572 6:168466175-168466197 TCTGAGAGCTGGAACATTGGGGG + Intronic
1019960822 7:4458015-4458037 TCTGATGGCTGTAACCTTAGAGG + Intergenic
1025295003 7:57769993-57770015 CCTGAAGACTGGACTCCTGGGGG + Intergenic
1025300939 7:57819419-57819441 CCTGAAGCCTGGACTCCTGGCGG + Intergenic
1026493929 7:70886884-70886906 TCTGAAGGCTGCTATCTATGAGG - Intergenic
1027825586 7:83111250-83111272 CCAGAAGGCAGAAATCTTGGGGG - Intronic
1030079748 7:105767243-105767265 CAGGAAAGCTGGAATCTTGGGGG - Intronic
1030983828 7:116216797-116216819 TCTGAAGGCTGTAATAGTGTGGG + Intronic
1031867182 7:127050338-127050360 TCAGAAGACTGGAACCATGGAGG + Intronic
1035085758 7:156256266-156256288 TCTGTAGGCTGAATTCTTAGCGG - Intergenic
1035718906 8:1776108-1776130 TCTGGAAGCTGGAATCTGTGAGG + Intronic
1035718923 8:1776244-1776266 TCTGGAAGCTGGAATCTGTGAGG + Intronic
1038489816 8:27962699-27962721 TCTGAGGGCTGGAATGGTTGGGG - Intronic
1039117072 8:34102686-34102708 TCAGAAGTCTGGAATTTTGCTGG + Intergenic
1039390040 8:37172093-37172115 TCTGCCTGCTGGAATCTTGGGGG + Intergenic
1039854137 8:41398102-41398124 TCCGAAGGGAGGAAGCTTGGTGG - Intergenic
1043429591 8:80182180-80182202 TCTGAAGGCAGCTCTCTTGGTGG + Intronic
1046145217 8:110149676-110149698 TCTGGAGGCTGGAAGGTGGGAGG - Intergenic
1047872596 8:129101475-129101497 TCTGAAACCTGGTGTCTTGGAGG - Intergenic
1048252263 8:132876489-132876511 CCAGAAGGCTGGAATCCTGTGGG + Intronic
1049480835 8:142821708-142821730 TCTGGAGGCTGGAATGTCTGTGG + Intergenic
1052931484 9:34059031-34059053 TCTGGAGGCTTGAACCTGGGAGG + Intergenic
1052991615 9:34522136-34522158 TTTGAGGGCTGCAAGCTTGGTGG - Intronic
1055040835 9:71869892-71869914 TCAGAAGGCTGAAATGTTTGAGG - Intronic
1056897429 9:90564020-90564042 TCTGAAGGCTGGGAGGTTAGGGG + Intergenic
1057020408 9:91692965-91692987 TCTAAAGGCTGGAAGTTTGAAGG - Intronic
1057518529 9:95741563-95741585 TCTGAGGCCTGGAATCTCAGTGG - Intergenic
1059234937 9:112752859-112752881 TCTGAAGGCTGGATTAGGGGAGG + Intronic
1061061612 9:128253459-128253481 TGTAAAGGCTGGGAGCTTGGAGG + Intronic
1061377538 9:130235183-130235205 TTTGAAGGGTGGATTCTTTGAGG + Exonic
1062183733 9:135205172-135205194 TCAGAAGGCTGGAGACATGGAGG + Intergenic
1186224102 X:7378872-7378894 TCAGATGGCTGGAATCAAGGTGG + Intergenic
1186744535 X:12553670-12553692 TGTGAAAGCTGGAGTCTTTGTGG + Intronic
1186927555 X:14351961-14351983 TCTTAAGGGTGCATTCTTGGGGG - Intergenic
1188300518 X:28502264-28502286 TCTGAAGACTGGAATCATGGAGG - Intergenic
1188506869 X:30892412-30892434 TCTGAAGGCAGAAAACTTGCTGG - Intronic
1189385718 X:40535157-40535179 TCTGGGGGTGGGAATCTTGGGGG + Intergenic
1192149683 X:68704484-68704506 GCTGGAGGCTGGGAACTTGGAGG + Intronic
1192416525 X:70985963-70985985 TCTGGAGGCTGGGATTCTGGAGG + Intergenic
1195088138 X:101432342-101432364 TTAGAAGGCTGGTGTCTTGGAGG - Intronic
1198170377 X:134099445-134099467 TCTGAAGGCCTGAAAATTGGTGG - Intergenic
1198555008 X:137783549-137783571 TCAGGAGGCAGGATTCTTGGAGG - Intergenic
1199764915 X:150934561-150934583 TCTCAAGGTTGGAGGCTTGGAGG - Intergenic
1201178071 Y:11321953-11321975 TCTGAATCCTGGACTCTGGGAGG - Intergenic
1201179646 Y:11332726-11332748 TCTGAATCCTGGACTCTGGGAGG - Intergenic
1201773931 Y:17644378-17644400 TTTAAAGGCTGAAATCTCGGTGG - Intergenic
1201827626 Y:18261611-18261633 TTTAAAGGCTGAAATCTCGGTGG + Intergenic