ID: 1160228939

View in Genome Browser
Species Human (GRCh38)
Location 18:77032071-77032093
Sequence TGTCCCACTGGAGAAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160228933_1160228939 0 Left 1160228933 18:77032048-77032070 CCGAGCTTTAAGCTGTGGCCCCT 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160228939 Original CRISPR TGTCCCACTGGAGAAGGCGC CGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900292731 1:1930382-1930404 TGTCCCTCTGCGGCAGGCGCGGG + Intronic
900343796 1:2201262-2201284 TGACCCTCTGGAGGATGCGCAGG - Intronic
900495481 1:2974150-2974172 CGTCCACCTGGAGAAGGCACAGG - Intergenic
900654139 1:3746882-3746904 TGTCCCACAGGAGAAGGGGGAGG + Intergenic
903218065 1:21854112-21854134 GGTCCCACTGAAGAAGCCACAGG + Intronic
911046831 1:93635682-93635704 GGTCCCACAGGGGATGGCGCTGG + Intronic
911411547 1:97515543-97515565 TGTCCCATGGAAGAAGGGGCAGG - Intronic
913244653 1:116860925-116860947 TGTGCCTCTGGAGAAGCCTCTGG - Intergenic
914869087 1:151458695-151458717 TGGCCCGCTGGGGAAGGGGCGGG - Intronic
916323564 1:163532904-163532926 GGTTTCACTGGACAAGGCGCTGG + Intergenic
919740266 1:200977058-200977080 AGTCTCACTGGAGAGGGCACAGG + Intronic
1066653881 10:37681972-37681994 TGTCGCCCTGGAGACGGCCCTGG - Intergenic
1067419483 10:46133949-46133971 GGTCCCACAGGAGCAGGCGGGGG + Intergenic
1067565355 10:47332140-47332162 TGACACACTGGAGAAGCCTCAGG - Intergenic
1068119889 10:52774637-52774659 TCTGCCACTGGAGCAGGAGCAGG - Intergenic
1072307800 10:94124085-94124107 TCTGCCACTGAAGAAGGGGCTGG + Intronic
1075224804 10:120618813-120618835 TGACCAACTGAAGAAGGCTCAGG + Intergenic
1076366881 10:129926898-129926920 TGTCCCCCGGGAGCAGGCTCTGG - Intronic
1077992245 11:7422419-7422441 TGAGCCACTTGAGAAGGAGCTGG + Intronic
1081643485 11:44774257-44774279 TGTCCCACGGGAGAAGGAGGGGG + Intronic
1081669910 11:44937121-44937143 TGTGCTCCTGGAGAAGGCACAGG + Intronic
1096783718 12:54005370-54005392 TGTTCCACTTGAGAAGGCAGCGG + Intronic
1097076389 12:56397679-56397701 TGTCCCAATTCAGAAGGGGCAGG + Intergenic
1110540973 13:76706633-76706655 GGTTCCCCTGGAGAAGGCTCTGG - Intergenic
1110960659 13:81620032-81620054 TGTCACAATGAAGAAGGAGCTGG - Intergenic
1114633381 14:24173516-24173538 TCTCCCACAGGAGATGGTGCAGG + Intronic
1118147651 14:63157602-63157624 TCTCCCACTGGAGAAATCGAGGG + Intergenic
1118636529 14:67753255-67753277 TGTGGCACTGGAGCAGGGGCTGG - Intronic
1119307501 14:73619497-73619519 TGTTCCATTGGAAAAGGCGCAGG + Exonic
1121019638 14:90571751-90571773 TGTTCCTCTGGATAAGGCCCAGG - Intronic
1122289827 14:100674589-100674611 CGTCCCAGTGGAGAAGGAGTGGG + Intergenic
1202860617 14_GL000225v1_random:79207-79229 TGTCCCACTGGGCAAGGGCCCGG + Intergenic
1124626030 15:31308059-31308081 TGTCCCTCAGGAGCAGGCGGTGG - Intergenic
1125490312 15:40142613-40142635 TGTGGCACTGGAGAAGGGGCTGG + Intergenic
1126181131 15:45785990-45786012 TTACCCACAGGAGAAGGTGCAGG - Intergenic
1132613895 16:831062-831084 TGACCCACGGCAGAAGGTGCCGG - Intergenic
1136604526 16:31324456-31324478 TGTCTCATTGAAGACGGCGCGGG - Exonic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1138683660 16:58705978-58706000 TGTCCCTCAGGAGAAGGCAAGGG + Intergenic
1141766127 16:86061003-86061025 GGTCCCTCGGGAGAAGGGGCAGG + Intergenic
1142239474 16:88938642-88938664 GGTGCCACAGGTGAAGGCGCTGG - Intronic
1142292486 16:89199449-89199471 TGCCCCCGTGGAGTAGGCGCAGG + Exonic
1147507576 17:41034765-41034787 TGTCCCACTGGTGGAGCAGCTGG + Exonic
1147935455 17:44008048-44008070 TGTTCCACTGGAGGCGCCGCAGG - Intronic
1151803498 17:76391353-76391375 TGCCCTGCTGGAGAAGGCCCAGG - Exonic
1152520216 17:80851663-80851685 TGTCCCACTGTAGGAGCTGCAGG - Intronic
1153226765 18:2906195-2906217 CGGCCCTCTGGGGAAGGCGCCGG - Intronic
1153423722 18:4938323-4938345 TGTGGCACTGGAAAAGGCACTGG + Intergenic
1154107224 18:11533582-11533604 CGTGCCACTGGAGCAGGAGCAGG - Intergenic
1154213311 18:12397878-12397900 TGTGCTACTGGAGAAAGGGCAGG - Intergenic
1155219284 18:23669826-23669848 TGACCCAGTGGACAAGGCACAGG + Intergenic
1157204109 18:45684062-45684084 TTCCCCTCTGGAGAAGGCGTGGG - Intergenic
1157592556 18:48844342-48844364 TGGTCCACAGGAGAAGCCGCTGG + Intronic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1161278869 19:3434382-3434404 TTACCCACTGGAGGAGGTGCTGG - Exonic
1161332632 19:3695559-3695581 TGTCCCAGTGGAGAGGCCTCGGG - Intronic
1162698380 19:12495355-12495377 TGTCCAATTGGAGACGCCGCCGG + Intronic
1164052169 19:21592866-21592888 TGACCCACTGGAGCCGGGGCTGG - Intergenic
1165460361 19:35940453-35940475 CGTCCCATTGGGGAAGGCGCGGG - Exonic
1166101937 19:40576368-40576390 TGGCCGCCTGGAGAAGCCGCTGG + Exonic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
925837384 2:7959464-7959486 TCTCGCACAGGAGAAGGTGCTGG + Intergenic
934674924 2:96242882-96242904 TGTGCCACTTGATAAGGGGCTGG + Intergenic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
1170245877 20:14220785-14220807 AGCCCCACTGGAGAAGCCGAAGG - Intronic
1170779307 20:19409549-19409571 TGTCTCATTGGAGAAGGAGTAGG + Intronic
1171770603 20:29319855-29319877 TGCCCCACTGAAGAACGCGGTGG - Intergenic
1174843484 20:53921243-53921265 TGTCTGACTGGATAAGGCACAGG + Intergenic
1179522946 21:41957082-41957104 TCTCCCACTGCAGAAGACACTGG + Intergenic
1180211017 21:46295556-46295578 TGTCCCCCTGGAGAGAGGGCTGG - Intronic
1181931563 22:26405787-26405809 TGGGCCACTGAAGAAGGGGCAGG + Intergenic
1184091386 22:42294797-42294819 TGTCCAACTGCAGCAGGTGCAGG + Intronic
952529081 3:34244552-34244574 TGTCACACTGTGGAAGGCGAGGG - Intergenic
961231057 3:125309759-125309781 AGATACACTGGAGAAGGCGCAGG + Intronic
962705065 3:138035241-138035263 TGTTCCACTGGAGAGAGCACTGG + Intergenic
963646820 3:147925328-147925350 TCACCTACTGGAGAAGGAGCTGG + Intergenic
964196548 3:154071465-154071487 TGTCCCACTGGACAATGAGAAGG - Intergenic
964670472 3:159219862-159219884 AGTCCCACCGGACAAGGCCCTGG + Intronic
966421527 3:179739157-179739179 TCTGCCAGTGGAGAAGGCTCAGG - Intronic
967857843 3:194131714-194131736 TGTCCCATTTGAGAAGGGGTGGG + Intergenic
970986944 4:22170124-22170146 CATCCCACTAGAGAAGGCACTGG + Intergenic
972728725 4:41771994-41772016 TTTCCCACTGGGGAAATCGCAGG + Intergenic
982159041 4:152548746-152548768 TATCCCACTGGGGAAGGATCTGG - Intergenic
985693556 5:1326973-1326995 TGTCCCTGTGGAGGAGGAGCTGG - Intronic
986438772 5:7759950-7759972 TGTCCCCCTGAAGAAAGCTCTGG - Intronic
987411678 5:17620981-17621003 TGGCCCACTGCAGGCGGCGCTGG + Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
992077143 5:73202145-73202167 GGTCCCATTGGAGAGGGCTCTGG - Intergenic
992350343 5:75921636-75921658 TGTCCCACTGGCCAATGCGGGGG + Intergenic
992359779 5:76025247-76025269 TGTCCCACTGGAGCATAGGCAGG + Intergenic
996241296 5:121206612-121206634 TCTACCACTGGAGAAGGGGAAGG - Intergenic
997672013 5:135683030-135683052 AATCCCACTGGAGAAGCCTCTGG + Intergenic
999133410 5:149301268-149301290 TGTCCCTCTGGAGGAGGCAAGGG + Intronic
1000411743 5:160940773-160940795 TGTGCCAGTGGTGAAGGCGGAGG + Intergenic
1001710031 5:173771181-173771203 TGTCTCACAGGAGAAGGGGGAGG - Intergenic
1006449924 6:34099851-34099873 TGTGGCCCTGGAGGAGGCGCTGG - Intronic
1017505607 6:155066110-155066132 CGTCTCAGTGGAGAAGGCCCAGG - Intronic
1018700006 6:166418909-166418931 TTTCCCACTAGAGGAAGCGCTGG - Intronic
1019329377 7:455158-455180 TGGGCCAGTGGAGAAGGCCCTGG - Intergenic
1019515547 7:1438347-1438369 GGTCTCCCTGGAGAAGGAGCAGG + Exonic
1019595034 7:1854508-1854530 TGTCACACGGGGGAAGGGGCGGG + Intronic
1020125016 7:5528741-5528763 TGTCACACTGGGGAAGCCACTGG + Intronic
1020373752 7:7461989-7462011 TCACCCACTGGAGCAGGCGCTGG + Intronic
1020910588 7:14125709-14125731 TGTCCCCCAGGAGAAGCCGCAGG + Intergenic
1021514274 7:21465745-21465767 TGTCCTACTGGAGAGGGCTGAGG + Intronic
1022843523 7:34188520-34188542 TGTCCCACTGGAAAACCTGCAGG + Intergenic
1024050940 7:45623069-45623091 TGTCCCACTGTAGACAGAGCTGG + Intronic
1026034744 7:66822999-66823021 TGTCCCTTTGGAGAAGGCGGTGG - Intergenic
1026955320 7:74372979-74373001 CCTGCTACTGGAGAAGGCGCAGG + Exonic
1032997519 7:137464406-137464428 TGTCCTACTGCAGAAGCAGCAGG - Intronic
1034137017 7:148780223-148780245 TGGCCCACTGGAGACTGGGCTGG + Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1038094625 8:24294063-24294085 TGTCTCACTGGAGAGGAGGCAGG + Exonic
1038446687 8:27609351-27609373 TGTGCCCCTGGAGAATGAGCTGG + Intronic
1039102178 8:33952132-33952154 TGTCCAACTGGAGACTGAGCTGG - Intergenic
1040661221 8:49578033-49578055 TCTGCCACTGGAGAAGTCCCAGG - Intergenic
1041227654 8:55716575-55716597 CTTCCCACTGGAGAAGTCGAAGG + Intronic
1043721157 8:83547954-83547976 TGGCCCTCTGGAGTAGGGGCTGG - Intergenic
1045478000 8:102569466-102569488 TGTCCCACTGGAGCTGGCCAAGG - Intergenic
1047796166 8:128257917-128257939 TGTCCCAGTTGAGAAGTGGCAGG + Intergenic
1049454175 8:142678606-142678628 TGGCCCTCTAGAGAAGGCCCAGG - Intronic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1059148587 9:111926048-111926070 TGTCCTAGTGGAAAAGGCTCAGG - Intronic
1062340967 9:136093917-136093939 TGTCCCACTGGAGAACAGGAGGG + Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1203364289 Un_KI270442v1:243674-243696 CGTCCCACTGAAGAAGGCGGTGG - Intergenic
1190980710 X:55454814-55454836 TGACCTTCTGGAGAAGGCCCAGG + Intergenic
1190987987 X:55518366-55518388 TGACCTTCTGGAGAAGGCCCAGG - Intergenic
1196192119 X:112805779-112805801 TATCCTACTGGAGAAGGAGTAGG - Intronic
1199096354 X:143745383-143745405 TGTGCTATTGGAGAAGGCCCTGG + Intergenic
1201178184 Y:11322389-11322411 TGTCCCACTGCACAAGGGCCCGG - Intergenic