ID: 1160233562

View in Genome Browser
Species Human (GRCh38)
Location 18:77067670-77067692
Sequence ACCGGGAGGCTGCTTCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160233552_1160233562 9 Left 1160233552 18:77067638-77067660 CCGCGCTGGCCCTGGTGCTACCC 0: 1
1: 0
2: 0
3: 17
4: 219
Right 1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 185
1160233553_1160233562 0 Left 1160233553 18:77067647-77067669 CCCTGGTGCTACCCACCAGCAGC 0: 1
1: 0
2: 2
3: 17
4: 159
Right 1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 185
1160233554_1160233562 -1 Left 1160233554 18:77067648-77067670 CCTGGTGCTACCCACCAGCAGCA 0: 1
1: 0
2: 3
3: 16
4: 183
Right 1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG 0: 1
1: 0
2: 1
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160233562 Original CRISPR ACCGGGAGGCTGCTTCTCTC GGG Intronic
905944590 1:41890943-41890965 CCTGGGAGGCTGCCTCTCTACGG + Intronic
908425360 1:64002002-64002024 ACAGGGAGGCTGTTTTTGTCAGG + Intronic
909875719 1:80799894-80799916 ATCGGGAGGCTGCCTTTCCCTGG + Intergenic
910093857 1:83497321-83497343 ACTGGGAAGCTGCCACTCTCAGG - Intergenic
912041700 1:105398508-105398530 ACCAGCTGGTTGCTTCTCTCTGG + Intergenic
912555651 1:110514189-110514211 TCAGGGAGGCTGCTTCTCCAGGG - Intergenic
914772920 1:150706781-150706803 ACCGGGAGGCTGGTAATCTGGGG + Exonic
921055903 1:211542273-211542295 ACTGGGAGGCAGCTCCTCGCAGG - Intergenic
922745060 1:228038793-228038815 ACAGGGAGACTGCTCCTCACTGG + Intronic
1067161306 10:43826902-43826924 GCGGAGAGGCTGCTGCTCTCAGG - Intergenic
1067512229 10:46905667-46905689 ATTGGGAAGCTGCCTCTCTCTGG - Intergenic
1067650015 10:48146155-48146177 ATTGGGAAGCTGCCTCTCTCTGG + Intergenic
1067690626 10:48499154-48499176 CCCGGGGGGCTGCCTCCCTCTGG + Intronic
1070543480 10:77434421-77434443 GTCGGGAGACTGGTTCTCTCAGG - Intronic
1070802208 10:79250440-79250462 ACAGCCAGGCAGCTTCTCTCTGG - Intronic
1071712908 10:88067210-88067232 ATCAGAAGGCTGGTTCTCTCTGG + Intergenic
1072682336 10:97516434-97516456 ACTGGGAGGCTGCCCCTTTCAGG + Intronic
1075442560 10:122491576-122491598 ACCGTGCGGCTGCTTCTGGCCGG + Intronic
1077038422 11:506668-506690 CCCGGGAGGCCGCTTCTTTGGGG + Intronic
1077151819 11:1076200-1076222 CCCTGGAGGCTGCATGTCTCTGG + Intergenic
1077782944 11:5351780-5351802 CCATGGAGCCTGCTTCTCTCAGG + Exonic
1077990169 11:7400760-7400782 ACTAGGAGGTGGCTTCTCTCGGG - Intronic
1079563118 11:21847799-21847821 TCAGGGAGGCTGCTTCTCCGAGG - Intergenic
1079766495 11:24399991-24400013 AAAGAGAGGCTGCTACTCTCAGG - Intergenic
1080962861 11:37180641-37180663 CCCAGGATGCTGCTTCTCCCTGG - Intergenic
1088743437 11:112785276-112785298 ACCCGGATGCTGATTGTCTCTGG + Intergenic
1089726553 11:120485662-120485684 TCCAGTAGGCTGCTTCTCTGAGG + Exonic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1091757883 12:3067135-3067157 CCCAGGAAGCTGCTTCTCCCTGG - Intergenic
1092937614 12:13378671-13378693 AGTGGGAGGCAGCTTCTCTGGGG - Intronic
1101830072 12:108249975-108249997 ACTGGGAGGTTGACTCTCTCTGG + Exonic
1102466680 12:113134538-113134560 ACCTTGAACCTGCTTCTCTCTGG - Intronic
1103335220 12:120184227-120184249 TGCGGGAGGCTGCATCTCTAGGG + Exonic
1107736282 13:43401721-43401743 ATTGCGAGGTTGCTTCTCTCTGG - Intronic
1111451867 13:88429147-88429169 ACCGGCAGGTTGCTTCTCTCTGG - Intergenic
1112026219 13:95413743-95413765 ACCAGGAGGCTGCTCACCTCCGG - Intergenic
1112185163 13:97120981-97121003 ACTGGGATTCTGATTCTCTCTGG - Intergenic
1113967879 13:114164815-114164837 CCTGGGAGGCTGCTTGTCTTTGG - Intergenic
1114281400 14:21195567-21195589 ACCAGGAAGTTGCTTCTCCCTGG - Intergenic
1115147132 14:30238905-30238927 ATTGGGAGACTGCCTCTCTCTGG - Intergenic
1121258881 14:92552265-92552287 AGCACGAGGCTGCTGCTCTCAGG - Intronic
1121803941 14:96797781-96797803 ACCGGGAAGCCGGTTCTGTCAGG + Intronic
1122422586 14:101586943-101586965 ACAGGGAGGTTCCTTCTCTACGG - Intergenic
1122465845 14:101932989-101933011 ACCTGGAGGTTTCTTCTTTCGGG + Intergenic
1202853354 14_GL000225v1_random:35727-35749 CCAGGGAGGCATCTTCTCTCTGG + Intergenic
1202854454 14_GL000225v1_random:42168-42190 CCGGGGAGGCATCTTCTCTCTGG + Intergenic
1202855902 14_GL000225v1_random:52193-52215 CCGGGGAGGCATCTTCTCTCTGG + Intergenic
1202856860 14_GL000225v1_random:57468-57490 CCGGGGAGGCATCTTCTCTCTGG + Intergenic
1202859809 14_GL000225v1_random:73830-73852 CCGGGGAGGCATCTTCTCTCTGG - Intergenic
1202862490 14_GL000225v1_random:91128-91150 CCGGGGAGGCATCTTCTCTCTGG - Intergenic
1202921663 14_KI270723v1_random:34035-34057 CCGGGGAGGCATCTTCTCTCTGG + Intergenic
1202923251 14_KI270724v1_random:3545-3567 CCGGGGAGGCATCTTCTCTCCGG - Intergenic
1124010742 15:25836611-25836633 ACAGGGAGGCTGCTCAGCTCTGG - Intronic
1126098642 15:45106623-45106645 TCAGTGAGTCTGCTTCTCTCTGG - Exonic
1126676529 15:51163593-51163615 ACAGGGTGGCTGCTGCTATCTGG - Intergenic
1132521612 16:392788-392810 ACAGGGGAGCTGCTTCTCCCAGG + Intergenic
1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG + Intergenic
1133817122 16:9206432-9206454 ACCTGGATGTTGCTTCTTTCTGG + Intergenic
1133937309 16:10279788-10279810 ACCCAGAGGCTCCCTCTCTCTGG + Intergenic
1137754064 16:50887649-50887671 ATTGGGAGACTGCTTTTCTCTGG + Intergenic
1138401533 16:56748923-56748945 CCCGGGAGGCTGCTTCTGAAAGG + Intronic
1138723563 16:59110651-59110673 CCTGGGAAGTTGCTTCTCTCTGG + Intergenic
1141918168 16:87114977-87114999 AGCGGGTTGCTTCTTCTCTCTGG - Intronic
1142000715 16:87662706-87662728 ACTGGCAGGCTGCTTTCCTCTGG + Intronic
1142802007 17:2352202-2352224 CCAGGAAGGCTGCTCCTCTCCGG + Intronic
1144026313 17:11278989-11279011 AACACGAGGCTGCTTCTCTGTGG - Intronic
1145264831 17:21374720-21374742 CCTGGGAGGCTGTTTCTCCCAGG + Intergenic
1147815835 17:43209616-43209638 ACCAGGAGAATGCTTCACTCGGG - Intronic
1147918251 17:43901136-43901158 ACCGGGAGGCAGCCTCACTTGGG + Intronic
1148792768 17:50183051-50183073 TCCGGGTGCCTGGTTCTCTCTGG + Intergenic
1151051799 17:70986385-70986407 ACTGGGAGACTGCTTTTCCCTGG + Intergenic
1152756387 17:82088761-82088783 ATCGGCAGGCTGCACCTCTCAGG - Exonic
1153235678 18:2984791-2984813 ACTGGGGGGCTTCTTCTCCCTGG - Intronic
1153538863 18:6133744-6133766 ACTGGGAGGCTGCCTTTCCCTGG - Intronic
1154331182 18:13430084-13430106 GCCGGGAGGCTCTTTCCCTCTGG - Intronic
1155611249 18:27670197-27670219 GCCTGAAGGCTGCTTCACTCTGG - Intergenic
1156018303 18:32570833-32570855 CCCAAGAAGCTGCTTCTCTCTGG - Intergenic
1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG + Intronic
1160242346 18:77132743-77132765 GGCCGGAGGCTGCTTCTCTCTGG + Exonic
1160531354 18:79566923-79566945 GCCTGGAAGCTGCTTCTCTGAGG + Intergenic
1160744536 19:704417-704439 AACTCGAGGCAGCTTCTCTCCGG + Intergenic
1161660723 19:5544266-5544288 CCTGGGAGGCTGTTCCTCTCAGG - Intergenic
1162109449 19:8392114-8392136 ACCGTGAGGCAGCTGCTCCCAGG + Intronic
1163020294 19:14477941-14477963 ACAGGGAGGGGGCTCCTCTCAGG + Exonic
1163551395 19:17967876-17967898 TCCTGGAGGCTGCCTCCCTCGGG - Intronic
1164735576 19:30538671-30538693 TCCTGGAGGCTGCCTCACTCTGG + Intronic
1165579077 19:36846843-36846865 AGGGAGAGGCTGCTCCTCTCAGG + Intronic
1166617376 19:44262309-44262331 ACAGGGAAGCTGGTCCTCTCTGG + Intronic
1167704163 19:51068641-51068663 ACCAAGAGTCTGCTTCTCACTGG - Intergenic
925289606 2:2738605-2738627 ACAGGGAGGCTGCTTCTCAAAGG + Intergenic
926094865 2:10074517-10074539 ACTGAGAAGCTGCTTGTCTCTGG + Intronic
926202957 2:10814336-10814358 CCAGGGAGGCTGCTTGTCCCGGG + Intronic
929851167 2:45591848-45591870 TCCGGGAAGTTGCTTCTCCCTGG - Intronic
935292094 2:101619608-101619630 ACTGGGAGACTGCCTTTCTCTGG + Intergenic
938279035 2:130051756-130051778 ACAGGGATGGTGCTTCCCTCAGG - Intergenic
938330018 2:130442632-130442654 ACAGGGATGGTGCTTCCCTCAGG - Intergenic
938359927 2:130678871-130678893 ACAGGGATGGTGCTTCCCTCAGG + Intergenic
938436335 2:131285592-131285614 ACAGGGATGGTGCTTCCCTCAGG + Intronic
938794598 2:134707012-134707034 ACCCGGAGGCTGCTTCTGAGAGG - Intronic
939918235 2:148074952-148074974 ACCCAGAGGATGCTTTTCTCTGG - Intronic
941205140 2:162562695-162562717 ACTGGCAAGCTGCTTCTCTTTGG - Intronic
943841008 2:192580673-192580695 AAGGGGAAGCTGCTTCTTTCTGG + Intergenic
947634454 2:231673046-231673068 ACCCGCAAGCTGCTTCCCTCCGG + Intergenic
948482473 2:238258863-238258885 GCCTGGTGTCTGCTTCTCTCTGG + Intronic
948713542 2:239841414-239841436 TCTGGGAGGCTGCTTCTATATGG + Intergenic
1169851937 20:10061730-10061752 ACAGGCAGGCTTCTTCCCTCTGG - Intergenic
1170954349 20:20964688-20964710 ACCGTGGGGCTCCTGCTCTCTGG - Intergenic
1171398959 20:24859301-24859323 ACCTGGGGGCGGCTTCCCTCAGG - Intergenic
1171880862 20:30616727-30616749 ACAGGGATGGTGCTTCCCTCAGG - Intergenic
1174102305 20:48137033-48137055 ACCGTCCGGCTGCTCCTCTCTGG - Intergenic
1174487508 20:50870663-50870685 ACCGGCAGTCTGCTTTTCACGGG + Intronic
1175645528 20:60667465-60667487 ACAGGGTTGCTGCTCCTCTCGGG - Intergenic
1178167886 21:30002817-30002839 ACCAGGAAGTTGCTTCTCTCTGG - Intergenic
1182719795 22:32387831-32387853 ATGGGGAGGCTGCTGCTTTCAGG - Exonic
1182880859 22:33732250-33732272 TCCCCGAGGCTGCTTCTCTGTGG - Intronic
1183255511 22:36759108-36759130 ACCTGCAGGCTGCTTCTCACAGG - Intronic
950451674 3:13068914-13068936 ACTGAGAGGGTGCTGCTCTCAGG - Intronic
950542773 3:13622105-13622127 ACCCGGAGGCTGCTTTCCCCAGG + Intronic
952297937 3:32077494-32077516 CCCAGGAAGCTGCTTCTCCCTGG - Intronic
952936721 3:38404404-38404426 GCCAGCAGGCTCCTTCTCTCTGG + Intronic
953138528 3:40205187-40205209 CCTGCAAGGCTGCTTCTCTCTGG + Intronic
953883138 3:46701690-46701712 CCCGGGAGACTGGATCTCTCAGG - Intronic
958532392 3:95350101-95350123 ACAGGGAGACTGCCTTTCTCTGG - Intergenic
959840916 3:110973507-110973529 ACCGGGAGGGTACTTTTCTGAGG - Intergenic
963734028 3:148999514-148999536 CTTGGGAGGCTGCTTCTCTCTGG + Intronic
964164194 3:153681876-153681898 TCAGGCAGGCTGCTTCTCTGAGG - Intergenic
964409830 3:156386452-156386474 ACAGGGAAGTTGCATCTCTCTGG + Intronic
966782454 3:183595458-183595480 CCCGGGAAGTTGCTTCTCCCTGG - Intergenic
966936280 3:184711787-184711809 ACCGGGAGCCCCCTGCTCTCTGG + Exonic
967120816 3:186381249-186381271 ATCGGGAGACTGCTTTTCTCTGG - Intergenic
969901578 4:10355130-10355152 ACAGGGAATCTGCTTCTCCCTGG - Intergenic
970588317 4:17535683-17535705 AGAAGGAGGCTGCATCTCTCTGG - Intergenic
974691015 4:65298171-65298193 CCCGGGAAGCTGCTTCTCCCTGG - Intergenic
974876621 4:67710545-67710567 CCCGGGAAGTTGCTTCTCACTGG + Intergenic
975365244 4:73521146-73521168 ACAGGGAGGCTCATACTCTCGGG - Intergenic
976010150 4:80476904-80476926 CCCTGGAGCCTGCTTTTCTCAGG + Intronic
979769753 4:124508195-124508217 CCCAGGAAGTTGCTTCTCTCTGG - Intergenic
983781355 4:171674270-171674292 ACTGGGAGACTGCCTTTCTCTGG + Intergenic
984245350 4:177268669-177268691 ACCGGCTGGTTGCTCCTCTCTGG - Intergenic
985578401 5:684256-684278 ACTGGGGGGCTGCTTCCCCCTGG - Intronic
985593330 5:776396-776418 ACTGGGGGGTTGCTTCTCCCTGG - Intergenic
985789335 5:1916774-1916796 ACCTGGCGGCTGCCCCTCTCAGG + Intergenic
986408755 5:7453997-7454019 ACAGGGAGACTGCTTTTCCCTGG + Intronic
987205304 5:15619239-15619261 CCCGGGAAGCTGTTTCTCCCTGG + Intronic
989634123 5:43516303-43516325 CCCAGGAAGTTGCTTCTCTCTGG - Intergenic
993273025 5:85819164-85819186 CCCCGGAAGTTGCTTCTCTCTGG + Intergenic
997640006 5:135442826-135442848 CCCTGGAGGCTGCATTTCTCAGG + Intergenic
1002053803 5:176586820-176586842 ACCGGGAGGTGGCTTCTGTCCGG + Exonic
1002096575 5:176834800-176834822 ACCAGGAGACAGCTTCTCCCTGG - Intronic
1002382469 5:178840434-178840456 ACTCGGAGGCTGGTTCTCCCTGG - Intergenic
1002648105 5:180672242-180672264 ACGTGGAGGCTGGTTCTCCCTGG + Intergenic
1002694215 5:181073438-181073460 CCAGGGAGGCTTCTCCTCTCAGG - Intergenic
1002898164 6:1390875-1390897 ACCGGGCTGCTGCTGCTGTCCGG - Exonic
1004916152 6:20334067-20334089 AGGGAGAGGCTGATTCTCTCTGG - Intergenic
1007118699 6:39362679-39362701 CCCTGGAAGCTGCTCCTCTCAGG - Intronic
1018148892 6:160920388-160920410 TCTGGGGGGCTGCTGCTCTCTGG - Intergenic
1019182628 6:170200578-170200600 TCGGGGAGGCTGCTCTTCTCCGG - Intergenic
1019610796 7:1935789-1935811 GCCTGGAGGCTGCTGCTTTCTGG - Intronic
1024237657 7:47410080-47410102 CCCTGGAGGCTCCTTCTCCCAGG - Intronic
1024887577 7:54161864-54161886 CCCGGGAAGTTGCTTCTCCCTGG + Intergenic
1026352147 7:69526718-69526740 GCCAGGAAGTTGCTTCTCTCTGG - Intergenic
1029673495 7:102050027-102050049 CCCGGGAGTCTGCTCCTATCAGG - Intronic
1032440668 7:131940783-131940805 ACCTGGCTGCTGCTTCTTTCCGG + Intergenic
1035529745 8:341765-341787 GCCGCGTGGCTGCTTCTCCCTGG - Intergenic
1037768646 8:21786622-21786644 AGCCAGAGGCAGCTTCTCTCTGG - Intronic
1038840957 8:31184306-31184328 AGAGACAGGCTGCTTCTCTCTGG - Intergenic
1039477097 8:37844766-37844788 CCCCGGTGGCTCCTTCTCTCGGG + Exonic
1039798777 8:40936808-40936830 ACGGGGAGGCAGCTTCTGGCAGG + Intergenic
1042271634 8:66961837-66961859 ACCAGGGGGCTGCGCCTCTCGGG - Intronic
1042761704 8:72278184-72278206 ACTGGGAGACTGCTTTTCCCTGG - Intergenic
1044016818 8:87055641-87055663 TCAGGCAGGCTGCTTCTCTGAGG + Intronic
1046650608 8:116833100-116833122 ACAGGGAGGCTGCTGCTCTGAGG + Intronic
1047356850 8:124129958-124129980 AACAGGAGGCTGTTCCTCTCAGG - Intergenic
1049379869 8:142306640-142306662 ACTGGGGGGCTGCTACTCACAGG - Intronic
1052180299 9:25518325-25518347 ATCAGGAGGCTGCTTCTCCTTGG - Intergenic
1052620141 9:30898258-30898280 CCCAGGAAGCTGCTTCTCTCTGG - Intergenic
1052880636 9:33599263-33599285 ACAGGGATGGTGCTTCCCTCAGG + Intergenic
1052938085 9:34110158-34110180 GCAGGGAGTCTGCTGCTCTCAGG - Intronic
1053495337 9:38544948-38544970 ACAGGGATGGTGCTTCCCTCAGG - Intronic
1055985893 9:82056364-82056386 ACAGGGATGGTGCTTCCCTCAGG + Intergenic
1056585447 9:87924766-87924788 ACAGGGATGGTGCTTCCCTCAGG - Intergenic
1056611433 9:88128177-88128199 ACAGGGATGGTGCTTCCCTCAGG + Intergenic
1057675234 9:97132305-97132327 ACAGGGATGGTGCTTCCCTCAGG - Intergenic
1061263960 9:129495154-129495176 CCAGGGAGGCGGCTTCTCTCTGG - Intergenic
1061530061 9:131204001-131204023 ACCTGGAGGCAGCATCACTCTGG - Intronic
1062514409 9:136925463-136925485 ACCGGCATTCCGCTTCTCTCTGG - Intronic
1188506386 X:30889112-30889134 ACCAGGCGGCTGCTGCTCTCTGG + Intronic
1189055496 X:37695219-37695241 TACTGGAGGCTGCTTCTCTTGGG + Intronic
1190482296 X:50889579-50889601 ATCGGGAGGCTGCAACCCTCTGG - Intergenic
1192149527 X:68703551-68703573 CCGGGGAGGCCACTTCTCTCAGG + Intronic
1192222130 X:69204428-69204450 GCTGGGAAGCTGCTTCTCCCAGG + Intergenic
1193485336 X:82079799-82079821 ACCGGGAAGTTGCTTCCCTCTGG - Intergenic
1195635912 X:107115922-107115944 ACCAGGAAACTGCTTCTCTCAGG - Exonic
1196924115 X:120615237-120615259 ATAGAGAGCCTGCTTCTCTCAGG + Intronic
1197827072 X:130601111-130601133 ACCAGCAGCCTGCTCCTCTCAGG + Intergenic
1198486746 X:137094990-137095012 ACAGTGATGCTTCTTCTCTCTGG + Intergenic
1201176703 Y:11314287-11314309 CCAGGGAGGCATCTTCTCTCTGG + Intergenic
1201177829 Y:11320934-11320956 CCGGGGAGGCATCTTCTCTCTGG + Intergenic
1201400943 Y:13603115-13603137 CTGGGGAGGCTGCTTTTCTCTGG + Intergenic
1202178542 Y:22119734-22119756 ACAGGGAAGCTTGTTCTCTCAGG - Intergenic
1202212819 Y:22466660-22466682 ACAGGGAAGCTTGTTCTCTCAGG + Intergenic