ID: 1160234196

View in Genome Browser
Species Human (GRCh38)
Location 18:77072908-77072930
Sequence TGACAATGGCTGAACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160234196_1160234200 1 Left 1160234196 18:77072908-77072930 CCTGGCCTGTTCAGCCATTGTCA 0: 1
1: 0
2: 3
3: 12
4: 175
Right 1160234200 18:77072932-77072954 CAATGGTCAACCCTCCTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160234196 Original CRISPR TGACAATGGCTGAACAGGCC AGG (reversed) Intronic
901234046 1:7657977-7657999 TGACAACCGCCGATCAGGCCAGG - Intronic
901898505 1:12336784-12336806 TGACAATATCTGAAAAGCCCTGG - Intronic
902696145 1:18142387-18142409 TGGCAAAGGCGGAACAAGCCAGG - Intronic
905110085 1:35588592-35588614 TGAGAAGGCCTGAAGAGGCCAGG - Intronic
905364585 1:37443125-37443147 TGAGAATGGGTGTACAGTCCAGG - Intergenic
906705985 1:47895585-47895607 TGACAAAGTCTGAACAGGGTTGG - Intronic
907585324 1:55611753-55611775 TGTCAGTGGCTGAACAGGTAGGG + Intergenic
909533433 1:76707044-76707066 TAACAATGGGTGGAAAGGCCAGG - Intergenic
911472163 1:98332452-98332474 TGACAGTGGCTGAAAAGCTCTGG - Intergenic
913252856 1:116926347-116926369 TGAAAATGGCTGAGCAGGGAGGG + Intronic
915084417 1:153375341-153375363 TAAGAATGGCTAAGCAGGCCGGG - Intronic
915525173 1:156471656-156471678 TGACACTGGCCGCAGAGGCCTGG - Intronic
916851991 1:168713169-168713191 CTACAGTGGGTGAACAGGCCTGG - Intronic
918325585 1:183407110-183407132 TAAGAATGGCAGATCAGGCCAGG - Intronic
918992461 1:191715346-191715368 TGACAATGGTAGTAGAGGCCAGG - Intergenic
919320474 1:196030577-196030599 TGACAATGGGTGAACTTGGCTGG - Intergenic
920760422 1:208778728-208778750 TGACAACCACTGAACGGGCCAGG + Intergenic
921009591 1:211127993-211128015 TGAAAATGCATCAACAGGCCAGG + Intronic
924068599 1:240253262-240253284 TAAAAATGAATGAACAGGCCAGG - Intronic
1063130062 10:3170698-3170720 TTAGAAAGGCTGAAGAGGCCGGG + Intronic
1064509975 10:16079788-16079810 TAAAAATAGCTGAAGAGGCCAGG + Intergenic
1066096770 10:32079713-32079735 TAAGAATGACTGTACAGGCCAGG + Intergenic
1066311626 10:34202904-34202926 TGACAATGGCTGTACTGAGCTGG + Intronic
1071887983 10:89971393-89971415 TGACCATGGCTGGTCAAGCCAGG + Intergenic
1072244253 10:93527568-93527590 TTAAAATTGCTGAACAGGCTGGG + Intronic
1072351800 10:94564379-94564401 TGACAATTTCTGACTAGGCCAGG - Intronic
1072749297 10:97965757-97965779 TGAGCATGGCTGCACAGCCCAGG - Intronic
1072944876 10:99800742-99800764 AGACAATGGGTGGAGAGGCCAGG + Intronic
1074113704 10:110440215-110440237 TAACGGTGGCTGAACAGGCCGGG + Intergenic
1075229925 10:120667209-120667231 AGACAATGGCTGAGCAGGTCTGG + Intergenic
1078009769 11:7563868-7563890 TAAGAATGGTGGAACAGGCCAGG + Intronic
1078431056 11:11289129-11289151 TGACAAGGCCTGAAGAAGCCAGG - Intronic
1078509846 11:11977073-11977095 TGCCAATGTCTGCAAAGGCCTGG + Intronic
1080002185 11:27362798-27362820 TGAAAAGGGCTGAATCGGCCGGG + Intronic
1080025972 11:27615693-27615715 TTATTTTGGCTGAACAGGCCAGG + Intergenic
1083527554 11:63383753-63383775 TAAAAATGGATGAACAGGTCGGG + Intronic
1083985912 11:66215225-66215247 TGAAAATGGCTGCTCGGGCCAGG - Intronic
1087646466 11:100813897-100813919 TGAAAATAGCAGAACAGGCCGGG + Intronic
1091956078 12:4644614-4644636 TAAAATTGGCTGAGCAGGCCAGG + Intronic
1096527508 12:52220132-52220154 TAATAATGGCAAAACAGGCCAGG - Intergenic
1097291579 12:57920663-57920685 TCACCATGACTGATCAGGCCAGG - Intergenic
1098028728 12:66232714-66232736 TGACAAAGGCAAAACAGGCAGGG - Intronic
1107546717 13:41440220-41440242 TGACACTGTCAGAACAGGCAAGG + Intergenic
1107987371 13:45786965-45786987 TGACATTAGCTGTACAGGTCAGG - Intronic
1110217818 13:73043006-73043028 TTAAAATTGCTGAATAGGCCAGG + Intergenic
1111704358 13:91730046-91730068 GGACAATGGCTAAACATGGCTGG - Intronic
1113508572 13:110833140-110833162 AGACCATGGCTCACCAGGCCAGG + Intergenic
1117717642 14:58597430-58597452 TAAAAATGGCTTCACAGGCCGGG + Intergenic
1117859163 14:60072047-60072069 GGAGAATGACAGAACAGGCCCGG - Intergenic
1118151155 14:63192288-63192310 TGACAAAGGCTGAGCAGGGCTGG + Intergenic
1119756403 14:77123070-77123092 TGCAAATGGCTGACCAGGCACGG - Intronic
1119897150 14:78229944-78229966 TGTCAATGGCTGAAGAGAACTGG - Intergenic
1120873155 14:89355968-89355990 TGGCCAGGGCAGAACAGGCCTGG - Intronic
1121022873 14:90592411-90592433 TTAAAATGCCTGCACAGGCCAGG + Intronic
1122973866 14:105163217-105163239 TGACAATGGTGGCAGAGGCCTGG - Intronic
1126167164 15:45663311-45663333 TAACAATGCCTCAGCAGGCCGGG - Intronic
1126634447 15:50767125-50767147 TGAAAGTGACTGGACAGGCCGGG - Intergenic
1127474302 15:59318196-59318218 AGATAATGGCTGGAGAGGCCTGG - Intronic
1132279594 15:100601965-100601987 TGACAAGCGCTGAACAGGGGCGG + Intronic
1134109498 16:11506414-11506436 AGACAGTGGCAGAACAGGACTGG - Intronic
1141253031 16:82376051-82376073 TGAAAAGGGCTTAGCAGGCCAGG - Intergenic
1142252427 16:88998544-88998566 TCACAATGGGTGAACAGACAGGG + Intergenic
1142512840 17:408594-408616 TGAAAATGGCTGCAGAGGCTGGG - Intergenic
1142625891 17:1191643-1191665 TGAATATGTCAGAACAGGCCAGG - Intronic
1150484712 17:65535868-65535890 TAACAGTGGCTGAAGAGGCCAGG + Intronic
1150498665 17:65629265-65629287 TGAAAATAGCTAAACAGGCTGGG - Intronic
1153672915 18:7429609-7429631 AGACCGTGGCTGAACAGGCCAGG + Intergenic
1157304654 18:46508139-46508161 TGCTAATGGCTGAACAGGGGAGG + Intronic
1158127717 18:54120378-54120400 TGACCTTGGCAGAACAGGTCAGG + Intergenic
1158864303 18:61623137-61623159 TGTCACTTTCTGAACAGGCCAGG + Intergenic
1160234196 18:77072908-77072930 TGACAATGGCTGAACAGGCCAGG - Intronic
1161312216 19:3601047-3601069 TGAAAATGGAGGAAAAGGCCGGG - Intronic
1161577769 19:5064343-5064365 TCACAGTGTCTGCACAGGCCTGG - Intronic
1162230944 19:9265740-9265762 TGACACTGTCAGAACAGGCAAGG + Intergenic
1164971644 19:32538017-32538039 TAAAAATGGCAAAACAGGCCAGG + Intergenic
928750456 2:34464759-34464781 TGATAAAGGAAGAACAGGCCAGG - Intergenic
929691660 2:44079938-44079960 TGACAATGGATGCAAAGACCTGG + Intergenic
931917045 2:66967720-66967742 TGACAGTGGCTAAACTGTCCAGG - Intergenic
934590652 2:95547144-95547166 TGACACTGTCAGAACAGGCAAGG - Intergenic
936465247 2:112742558-112742580 TGACAATGGCTGAAAGGGCCAGG + Exonic
937357438 2:121206904-121206926 AGAAAATGGCAGAACGGGCCAGG + Intergenic
937984046 2:127630652-127630674 GGCCCAGGGCTGAACAGGCCAGG - Intronic
940498058 2:154458888-154458910 TGTCCATGCCTGAACAAGCCAGG + Intergenic
943346807 2:186748216-186748238 TAAAAATGGTAGAACAGGCCTGG - Intronic
945724665 2:213461964-213461986 TGACAATGCCTGGACAGGCCAGG + Intronic
946510454 2:220350048-220350070 TGACAAAGACTGAACATTCCTGG + Intergenic
1168938143 20:1685767-1685789 GGACAGTGGCTGAACATCCCCGG + Intergenic
1169210452 20:3763714-3763736 TGACACTGGCTCATCAGTCCAGG + Intronic
1169522717 20:6390578-6390600 TAACAATGGAGGAATAGGCCGGG + Intergenic
1170940557 20:20844935-20844957 TGAAAACAGATGAACAGGCCGGG - Intergenic
1171965563 20:31527445-31527467 TGACAATGGCTCAGCACGGCTGG - Intronic
1173408475 20:42788270-42788292 TACCAATGCCTGAACTGGCCTGG + Intronic
1173736497 20:45365292-45365314 TGACTATGGCTCCATAGGCCTGG - Intronic
1175728266 20:61334061-61334083 TGACCAGAGCTGCACAGGCCAGG - Intronic
1175913865 20:62416684-62416706 CTACATGGGCTGAACAGGCCTGG + Intronic
1176025581 20:62983791-62983813 TAACAATGGCTGAATTTGCCGGG - Intergenic
1176103278 20:63374193-63374215 AGACAAAGGCTGAACGGGCCGGG + Intronic
1178462503 21:32815736-32815758 TCCAAATGGCTGAATAGGCCTGG - Intergenic
1178825523 21:36013073-36013095 TAAAAGTGGCTGCACAGGCCAGG - Intergenic
1179416274 21:41200981-41201003 GGACAGTGGCTGAGCTGGCCAGG - Intronic
1181792583 22:25279421-25279443 TGAAAATGGCAGAACATGGCTGG - Intergenic
1181813119 22:25417015-25417037 TGAAAATGGCAGAACATGACTGG - Intergenic
1181831099 22:25561222-25561244 TGAAAATGGCAGAACATGACTGG - Intergenic
1182834589 22:33331701-33331723 TAAAAATGGCTGCACAGGCCAGG - Intronic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1185003564 22:48262014-48262036 TGAAGATGGCTGAAGAGCCCTGG - Intergenic
953470711 3:43163638-43163660 AGACAATGGCTGCAGAGGGCAGG + Intergenic
953566007 3:44032655-44032677 TGACAAAGGCTGAACAGGCAAGG - Intergenic
953853547 3:46484131-46484153 TGTCAATGGCTGAAGAGGGAAGG + Intronic
954329880 3:49884244-49884266 TAATAAAGGCTGAGCAGGCCAGG - Intergenic
954499780 3:51000946-51000968 AGAAAATGGCAGAACAGGCTGGG - Intronic
955233425 3:57119589-57119611 TGGCCATCGCTGACCAGGCCTGG - Intronic
956786616 3:72648091-72648113 TGACAGGGGCTGATCAGGCTGGG + Intergenic
959297339 3:104553913-104553935 TTTCAATGGCAGAACTGGCCAGG - Intergenic
962607678 3:137045933-137045955 TAAAAAAGGTTGAACAGGCCGGG + Intergenic
966594810 3:181716123-181716145 TTACAATGGCTGGCCAGGCTAGG - Intergenic
967143086 3:186580134-186580156 TGACAACTGCAGAACAGGCTTGG - Intronic
967227412 3:187305325-187305347 TGACCATGGCTTACAAGGCCAGG - Intergenic
968760475 4:2440454-2440476 TAATAATTGCTGAACAGGCGGGG + Intronic
971867940 4:32196701-32196723 AAAAAATTGCTGAACAGGCCGGG - Intergenic
981098861 4:140809404-140809426 TGAAGATGGGTGTACAGGCCGGG + Intergenic
981748957 4:148075167-148075189 TTACAATGACTGCACAAGCCAGG + Intergenic
982066292 4:151657520-151657542 TGAGGATGGCTGGCCAGGCCTGG + Intronic
983631048 4:169849659-169849681 TCTCAATGTCTGAACAAGCCTGG + Intergenic
987201163 5:15579739-15579761 TGAGAATGGCAGAACTGGACAGG + Intronic
988058758 5:26138076-26138098 TGAAAATTGCTGGACAGTCCTGG + Intergenic
989055395 5:37361285-37361307 AGACAATGGCTGAACAGAAAAGG + Intronic
989465949 5:41755969-41755991 TGACAAAGGCAGCACAAGCCAGG + Intronic
991117904 5:62975592-62975614 TAACAATGCCTGTACAGACCAGG + Intergenic
991447345 5:66714474-66714496 TGCCACTGTCTGGACAGGCCTGG + Intronic
991680123 5:69131757-69131779 TGAAAAAGGCTAAATAGGCCGGG + Intergenic
992418159 5:76572731-76572753 TAAAAATAGCTGTACAGGCCAGG - Intronic
993026199 5:82649763-82649785 AGTCAATGGCTGAAAAGTCCTGG + Intergenic
993938714 5:94033244-94033266 ATACAATGGCAGAACAGGCATGG - Intronic
996218011 5:120892313-120892335 TGACAATGCCTGGACAGGATAGG + Intergenic
997131003 5:131276310-131276332 GGACTATGGGTGTACAGGCCTGG - Intronic
997251108 5:132389336-132389358 CGACAGTGGCTGAGGAGGCCAGG + Intronic
999837108 5:155386020-155386042 TGACAATGGCAGAGCAGGCAGGG + Intergenic
1001004535 5:168038787-168038809 TGAAACTGGGGGAACAGGCCAGG - Intronic
1001310623 5:170607720-170607742 TGACAATGGAGAAACTGGCCAGG + Intronic
1001630194 5:173169153-173169175 TGAGAGGGGCAGAACAGGCCCGG + Intergenic
1002003967 5:176216793-176216815 TGACACTGGGTGATCAGCCCAGG - Intergenic
1003160664 6:3631215-3631237 AGAAAATGGCTCAATAGGCCGGG - Intergenic
1003699544 6:8446729-8446751 TCATAAAGGCTGAACAGGCAGGG - Intergenic
1004112142 6:12729453-12729475 TGACAAGGCATGAACAGGCATGG + Intronic
1005955789 6:30662566-30662588 AGACAATGGCTGAATTGGCTGGG + Intronic
1010657960 6:78534798-78534820 TAAAAATGACAGAACAGGCCGGG + Intergenic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1012450972 6:99351937-99351959 TCAGAATGTCAGAACAGGCCGGG + Intergenic
1013186984 6:107767963-107767985 TAACAATGGCAGAACTGGCTGGG + Intronic
1013485363 6:110591207-110591229 TGACAATGACTCAACAGACAGGG + Intergenic
1013541227 6:111111774-111111796 TGACAATGGTAAAACAAGCCAGG - Intronic
1013774972 6:113669589-113669611 TGAAAATAGGTGCACAGGCCAGG + Intergenic
1018492090 6:164304051-164304073 TGACAATGGCTGACAAATCCAGG + Intergenic
1019855807 7:3606255-3606277 TGGCAATGGTTGATCAGACCTGG - Intronic
1020078158 7:5272329-5272351 TAACAATGGCTGGCCAGGCGCGG + Intergenic
1021648345 7:22808370-22808392 AGACATTGGCTGAAGAGACCAGG - Intergenic
1023421628 7:39985991-39986013 TGTCAGTGGCAGAACAGCCCTGG + Intronic
1024022873 7:45387352-45387374 TGACCATGGGAGAAGAGGCCTGG + Intergenic
1025200737 7:56959843-56959865 TAACAATGGCTGGCCAGGCGCGG - Intergenic
1025671206 7:63617089-63617111 TAACAATGGCTGGCCAGGCGCGG + Intergenic
1029978701 7:104858298-104858320 TGACAATGTCTGAGCAGGACAGG - Intronic
1031802465 7:126265242-126265264 AGACAATGGCTGAATGGGGCTGG - Intergenic
1032618924 7:133507656-133507678 TGACCATAGCTGAACATGACTGG + Intronic
1034760357 7:153666865-153666887 GGACAATGACTGAACATGCAGGG + Intergenic
1034823956 7:154243497-154243519 TAAGAATGGCAGAAGAGGCCGGG + Intronic
1035577637 8:717989-718011 AGAAAATGGCAGAACACGCCAGG + Intronic
1035883718 8:3269425-3269447 TGCCCATGGCAGAACAGGCTGGG - Intronic
1042846955 8:73177896-73177918 TGACAATGTCTAAAAATGCCTGG - Intergenic
1044173095 8:89081468-89081490 TGACAATAGCTGAGCATGGCAGG + Intergenic
1045367613 8:101491968-101491990 TGACAGTGGCAGAAGAGGACGGG - Intergenic
1048355727 8:133652557-133652579 TGACAATGGCATAACAGCCCAGG - Intergenic
1050699225 9:8318625-8318647 TGAAAATGGCTTCACAGGACTGG + Intronic
1051105837 9:13579176-13579198 TGAAAATTGCTGAAGAGGCCGGG + Intergenic
1051952757 9:22657026-22657048 TCATAACTGCTGAACAGGCCAGG + Intergenic
1052908889 9:33862146-33862168 TGAAAGTGGATCAACAGGCCGGG - Intronic
1053248583 9:36555647-36555669 TAAAAATGACTGAAGAGGCCGGG - Intergenic
1055751891 9:79515449-79515471 GGACAGTGGCTGAGCAGTCCTGG - Intergenic
1055978485 9:81977068-81977090 TGAAAATGGCGGATGAGGCCGGG - Intergenic
1060261802 9:122082206-122082228 TTAAAATGTCTGAAAAGGCCAGG + Intronic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1189254557 X:39627702-39627724 TGACAATGGGTGACCCAGCCCGG + Intergenic
1190699858 X:52979580-52979602 TGACATAGGAGGAACAGGCCAGG - Intronic
1194093243 X:89603588-89603610 AGAAAATGGCTTAACTGGCCAGG + Intergenic
1195907665 X:109861745-109861767 TGACATTTCCTGACCAGGCCTGG - Intergenic
1197571431 X:128155705-128155727 TGACAATGACTGACCATGTCCGG - Intergenic
1197707249 X:129643092-129643114 TCAGAATGGCTGCTCAGGCCAGG + Intergenic
1199270055 X:145872725-145872747 TGATGATGGCTGCTCAGGCCGGG + Intergenic
1199390830 X:147276426-147276448 TGAGAATGGGTTAACAGACCTGG + Intergenic
1200445875 Y:3259691-3259713 AGAAAATGGCTTAACTGGCCAGG + Intergenic