ID: 1160235150

View in Genome Browser
Species Human (GRCh38)
Location 18:77079777-77079799
Sequence GAATTTATTCTGAGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 1, 3: 59, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160235150_1160235154 -9 Left 1160235150 18:77079777-77079799 CCTTCCACACTCAGAATAAATTC 0: 1
1: 1
2: 1
3: 59
4: 340
Right 1160235154 18:77079791-77079813 AATAAATTCAGGTTCTGTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 329
1160235150_1160235153 -10 Left 1160235150 18:77079777-77079799 CCTTCCACACTCAGAATAAATTC 0: 1
1: 1
2: 1
3: 59
4: 340
Right 1160235153 18:77079790-77079812 GAATAAATTCAGGTTCTGTGTGG 0: 1
1: 0
2: 2
3: 22
4: 292
1160235150_1160235155 -5 Left 1160235150 18:77079777-77079799 CCTTCCACACTCAGAATAAATTC 0: 1
1: 1
2: 1
3: 59
4: 340
Right 1160235155 18:77079795-77079817 AATTCAGGTTCTGTGTGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160235150 Original CRISPR GAATTTATTCTGAGTGTGGA AGG (reversed) Intronic
900717076 1:4152113-4152135 GATTTTCTTCTGAGTCTGGCTGG + Intergenic
901600993 1:10423263-10423285 CAAACAATTCTGAGTGTGGAAGG + Intergenic
902892256 1:19452767-19452789 GAAATTATTCTGACTGCCGAAGG - Intronic
905345441 1:37308150-37308172 GAAAATATTCTAAGTGTGCAGGG + Intergenic
906225405 1:44117928-44117950 GATTTTATTCTAAGTGTGGCGGG - Intergenic
906651704 1:47517350-47517372 GAAACTATTCTGGATGTGGAGGG + Intergenic
907211143 1:52823791-52823813 GAAGTTATTCTGAGTAAAGAAGG - Exonic
909858592 1:80574258-80574280 GAATTTAATCAGAGTGTTTAGGG + Intergenic
910084700 1:83385674-83385696 GAATTTATTCCAAGTGTACAAGG + Intergenic
910145936 1:84079053-84079075 TAATTTCTTCTGAGAGCGGAAGG + Intronic
910223001 1:84907746-84907768 GAATTTATTCTAATTGTCGGGGG + Intergenic
910364254 1:86447243-86447265 GAATTTATTTGGAGTGAGGGAGG - Intronic
910369235 1:86498439-86498461 AAATTAATTCTGTGTGTGGAAGG + Intronic
910853608 1:91672251-91672273 GAATTTATTCTAAGTGTGATGGG + Intergenic
910990839 1:93054262-93054284 GAACTTATACTTAGTCTGGAGGG - Intergenic
911081579 1:93937956-93937978 TAATTTATTCTGTGTATTGATGG + Intergenic
911509806 1:98797624-98797646 GATTTTCTTCTGAGTGGTGAAGG - Intergenic
912265395 1:108152150-108152172 GATTTTATTCTGAATATGGTAGG - Intronic
912962673 1:114209838-114209860 GAATTTATTCAGTGTGTGAGTGG - Intergenic
913172100 1:116242398-116242420 AAATTTATTCTGAAAGTTGAAGG + Intergenic
914954760 1:152151553-152151575 GATTTTATTCTCAATGTGGAGGG + Intergenic
915008867 1:152665999-152666021 GAAATTATTCTGTGTATGGAGGG - Intergenic
915034061 1:152908037-152908059 AAATATATTCTGAGAGAGGAAGG + Intergenic
915296865 1:154927602-154927624 GATTTTATTCTGAGTGAGATGGG - Intronic
915538641 1:156553242-156553264 GTTTTTACTCTGAGTGAGGAAGG - Intronic
916520049 1:165555483-165555505 GATTTTATTCTAAGTGTGATGGG + Intronic
916744749 1:167676527-167676549 GAAATTATTTTGAGTCTGGTGGG - Intronic
917865194 1:179187903-179187925 GATTTTATTCTGAGTGGGATGGG - Intronic
918579832 1:186112932-186112954 GAATTTATTCTCACTGTAAATGG + Exonic
918660912 1:187087675-187087697 GGATTTATTCTGAGAACGGAAGG + Intergenic
919703345 1:200653589-200653611 GATTTTATTCTAAGTGTGATGGG - Intronic
919715796 1:200775378-200775400 GATTTTATTGTGAATGTGCAAGG + Intronic
923105429 1:230850418-230850440 GGATTTGTGCTGAGTCTGGAGGG + Intronic
923864582 1:237926427-237926449 GTATTTATTCTGAGTATGTAAGG - Intergenic
924413678 1:243834569-243834591 GAGTGTATTTTGAGGGTGGAGGG + Intronic
1063064055 10:2590910-2590932 GACTTTATGCTGAGTGTTGAAGG - Intergenic
1063750986 10:8947220-8947242 GAATTTATACTGAGTGTTCAGGG + Intergenic
1064404059 10:15045499-15045521 GATTTTTTTCTGAGAGTTGATGG + Intronic
1064477493 10:15706808-15706830 GATTTTATTCTAAGAGTGGTGGG - Intronic
1064709607 10:18109976-18109998 GAGTTGATTCTAAGTGTGCAAGG + Intergenic
1064963882 10:20995810-20995832 TAATTATTTCTGAGTGGGGAAGG + Intronic
1065070130 10:22014925-22014947 GAATTTATTCTTAGTGTGATGGG - Intergenic
1065766919 10:29038974-29038996 GATTTTATTCTGATGGAGGAGGG - Intergenic
1067266147 10:44747242-44747264 GTATTTATTTTGAGAATGGAGGG - Intergenic
1067697706 10:48547747-48547769 GAATTGCTCCTGAGTGTGGGGGG + Intronic
1068472591 10:57483714-57483736 GATTTTATTCTGAGAGTGTCAGG - Intergenic
1068711325 10:60138109-60138131 GAGTTTATTCTCAGTGTAGTTGG - Intronic
1068785956 10:60973812-60973834 GAATTTCTTCAAAGTGAGGAGGG + Intronic
1068834724 10:61541570-61541592 TAATTTATTCTGAATGTTGGGGG - Intergenic
1069095803 10:64258466-64258488 GAATTAATTGTAAGTGTGTAGGG + Intergenic
1071805072 10:89109881-89109903 GAATATTTTCAGATTGTGGAGGG + Intergenic
1073473865 10:103740376-103740398 GATTTTATTCTGCATGTGAAGGG + Intronic
1073717955 10:106129242-106129264 GAATTTATTCTAAGAGTTGTAGG + Intergenic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1074917639 10:117972535-117972557 GAATTTATTATGAGTAAGTAGGG - Intergenic
1076197505 10:128530037-128530059 GAATTTCTCCTGACTGTGGTTGG + Intergenic
1077523810 11:3051943-3051965 GAATCCATTCTGAGTGTGAGAGG - Intronic
1077796102 11:5494064-5494086 GAAGTTATGCTGAGTCTGGCTGG - Intronic
1078874148 11:15377066-15377088 GAATTTGTTCTGAGTTTGGCAGG + Intergenic
1078944202 11:16045522-16045544 CATTTTATTCTGAGTGTGATGGG - Intronic
1080197611 11:29630629-29630651 GAATTTATTCTGTGTTTCCAGGG - Intergenic
1080226632 11:29968864-29968886 GAATTTATAATGAGGGTGGGGGG + Intergenic
1080546235 11:33321773-33321795 GATAATCTTCTGAGTGTGGAAGG + Intronic
1080885891 11:36367876-36367898 GAATCTAATCTGGGTGAGGAGGG + Intronic
1081156770 11:39702970-39702992 CAATTTATTATGAGTGAGGTGGG - Intergenic
1081603952 11:44515148-44515170 GCATGTATTCTGAGTGTGGCAGG + Intergenic
1081634064 11:44709100-44709122 GGAATTATTCAGACTGTGGAGGG + Intergenic
1082212860 11:49526491-49526513 GAATCTATTCTATGTGTGGTTGG + Intergenic
1082803850 11:57434011-57434033 GCATTTATCATGATTGTGGAAGG + Intergenic
1083268452 11:61558164-61558186 GAATATATTATGAGTGGGCATGG + Intronic
1085200153 11:74696979-74697001 GATTTGGTTCTGAGGGTGGAGGG - Intronic
1085719950 11:78903738-78903760 GAATTTAAGCTCAGTGGGGACGG - Intronic
1086636736 11:89098019-89098041 GAATCTATTCTAAGTGTGGTTGG - Intergenic
1086836517 11:91631097-91631119 GAATTTGTTCTGGTTGTGGTGGG + Intergenic
1086857956 11:91889353-91889375 TATTTTATTCTGAGTGGTGATGG - Intergenic
1087107601 11:94426033-94426055 GAATATGTTCTGTGTGTAGATGG - Intronic
1087601822 11:100327027-100327049 GAATTTATTCTAAGTGCAAAAGG + Intronic
1087700156 11:101428155-101428177 TGATATATTCTGAGTGCGGAAGG - Intergenic
1088450143 11:109972976-109972998 GAATTTAATGTGGGTGTGGAGGG + Intergenic
1088527510 11:110772881-110772903 GACTTTGTTCTGAGTGTTGTGGG - Intergenic
1088635830 11:111819683-111819705 GAATTTATTATGTGTTTGGAAGG - Intronic
1088863204 11:113821409-113821431 GCATTTATTCTGAGTGAGCTTGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089801266 11:121030337-121030359 GATTTTATTCTGCATGTGAAGGG + Intronic
1090427582 11:126619408-126619430 GATTTTATCCTAAGTGTGGTGGG + Intronic
1090580493 11:128153652-128153674 TAATTTATACTAAGTGTTGAGGG - Intergenic
1091063947 11:132491278-132491300 GATTTTATTCTTAGTGTGTTGGG - Intronic
1092148661 12:6232224-6232246 GAAGTTAGCCAGAGTGTGGAAGG + Intronic
1092927168 12:13281834-13281856 GATTTTATTCTAAGTGTGATGGG - Intergenic
1092973469 12:13721290-13721312 GATTTTATTCTAAGTGTGACAGG + Intronic
1093221517 12:16426064-16426086 AAATCTATTAGGAGTGTGGAGGG - Intronic
1094055512 12:26265472-26265494 GATTTTAGTCTGAGTGAAGAAGG + Intronic
1095749511 12:45695748-45695770 GAATTTATGCTGAATGGGGTGGG + Intergenic
1096741524 12:53697083-53697105 GAATTCATTCCGAGCGGGGAGGG + Intergenic
1096923201 12:55112274-55112296 AAATTAATTGTGAATGTGGAAGG + Intergenic
1097626155 12:62002984-62003006 GAATTTAATCTGAGTAAGAAGGG - Intronic
1099071611 12:78051268-78051290 GAGGTTATTCAGAGTGTTGAAGG + Intronic
1099305117 12:80944500-80944522 GAATTTACTCTAAGTGTGCTGGG + Intronic
1099455543 12:82858362-82858384 GAGTTTATTCTGAGTGAAGGAGG - Intronic
1100390828 12:94145398-94145420 GAAATGAGTCTGATTGTGGATGG + Intergenic
1100890845 12:99124056-99124078 GATTTTATTCTGAGTGAGACAGG + Intronic
1101013891 12:100479609-100479631 GAAATCTTTCTGAGCGTGGAGGG - Intronic
1102809562 12:115812656-115812678 GACTTTATCCTGAGTGTGAAGGG - Intergenic
1103187711 12:118975362-118975384 GATTTTATTATGGGTATGGAAGG + Intergenic
1103798596 12:123522492-123522514 GATTTTATTCTAAGTGTGCTGGG - Intronic
1106518236 13:30473531-30473553 GCATTTATTCTGAAGGTGTAAGG - Intronic
1106670506 13:31899721-31899743 GAATTTATTAAGATTGTGGAAGG + Intergenic
1107686436 13:42905025-42905047 GAATTTATTATCAGTGTGAGAGG + Intronic
1108239449 13:48446864-48446886 GAATTTATTCTACGTGTGACAGG + Intronic
1109219553 13:59627448-59627470 GATTTTATTCTCAGTGTGTTGGG + Intergenic
1109232326 13:59773494-59773516 GAATGTGTTTTGACTGTGGAAGG + Intronic
1110665231 13:78109011-78109033 GATTTTATTCTGAGTGAGATGGG - Intergenic
1110960468 13:81616402-81616424 ATATTTACTCTCAGTGTGGAAGG - Intergenic
1111251845 13:85612209-85612231 GAATTTATAGTGATTGTGAATGG + Intergenic
1111397809 13:87689561-87689583 AAATTTATTCTTATTTTGGAAGG - Exonic
1111650471 13:91084438-91084460 GTTTTTATTATAAGTGTGGATGG + Intergenic
1111875525 13:93889384-93889406 GAAGTGATTCTGAATGTGGTTGG + Intronic
1112160001 13:96857147-96857169 GCTTTTATTCTGAGTGAGAAGGG - Intergenic
1112803625 13:103138460-103138482 GATTTTATTCTGTGTGAGGTGGG + Intergenic
1112959891 13:105110870-105110892 GAATTTATCCTAAGTTTGCAAGG - Intergenic
1112960071 13:105113087-105113109 GAATTTATTCTGAGCAGGGAGGG - Intergenic
1113706323 13:112435378-112435400 AAACTGATTCTGACTGTGGAGGG + Intergenic
1114893510 14:26956243-26956265 GATCTTATTCTGAGTGTGCTGGG - Intergenic
1115049418 14:29039152-29039174 GATTTTATTGTGACTGTAGAGGG + Intergenic
1115087753 14:29537807-29537829 GGAGTTATTCTGAGTGTTAAAGG + Intergenic
1115625953 14:35192054-35192076 GATTTTATTCTAAGTGTAAAGGG - Intronic
1115814247 14:37145798-37145820 GAATTTTGACTGTGTGTGGATGG - Intronic
1115871908 14:37814109-37814131 GATTTTATTCTAAGTGTGATGGG - Intronic
1116256666 14:42565610-42565632 GGGTTTATTCTGGGTATGGAAGG - Intergenic
1116315160 14:43377116-43377138 GAATATATTTTGAGTGTAAAGGG - Intergenic
1117412177 14:55460553-55460575 GATTTTAATCTGTGTGTGGTGGG + Intergenic
1117582151 14:57162299-57162321 GAAATTATTCTGAGTGTGTGGGG - Intergenic
1117984738 14:61376052-61376074 GATTTTATTCACAGTGTGGTGGG + Intronic
1118342979 14:64911507-64911529 GATTTTATTCTGCATGTGGTAGG - Intergenic
1119189233 14:72669063-72669085 GCATTTATTCTCAGTTTTGAGGG - Intronic
1119679015 14:76577896-76577918 TCACTTATTCTGAGTCTGGAAGG + Intergenic
1119726297 14:76923740-76923762 GGGTTTGTTCTGAGTGTTGAAGG + Intergenic
1121197311 14:92085499-92085521 GATTTTATTCTAAGTGTGCTGGG + Intronic
1123672747 15:22676509-22676531 GAATTTATTTTGATTGTGGTAGG + Intergenic
1124324799 15:28749799-28749821 GAATTTATTTTGATTGTGGTAGG + Intergenic
1124528651 15:30482823-30482845 GAATTTATTTTGAATGTGGTAGG + Intergenic
1124770005 15:32524874-32524896 GAATTTATTTTGAATGTGGTAGG - Intergenic
1124894930 15:33767560-33767582 GAATATATCCTGAGTGTTGATGG - Intronic
1125059009 15:35396410-35396432 GAATATATTTTGAGTATTGAAGG - Intronic
1126701231 15:51369532-51369554 GAATTCATTCTGAGAGTAAAAGG + Intronic
1129010186 15:72408946-72408968 AAATCTAGTCTGAGTGTGAAAGG - Intergenic
1129481402 15:75829480-75829502 GACTTTATCCTGAGAGTGGAGGG + Intergenic
1130318753 15:82821410-82821432 GAATTTATTTTGATTGTCGTAGG + Intronic
1131055972 15:89375340-89375362 GAATTTATTTAGAGTCTGGAGGG + Intergenic
1133114720 16:3570821-3570843 GGATTTGTTCTAAGTATGGAGGG + Intronic
1133197094 16:4178744-4178766 GGGTTTATTCTGAGTGTGAAGGG + Intergenic
1133458944 16:5969836-5969858 CAATATCTTCTCAGTGTGGATGG + Intergenic
1133537401 16:6715168-6715190 AAATTCATTATGAGTGAGGAGGG - Intronic
1134416594 16:14048606-14048628 GATCTTATTCTAAGTGTGGTGGG + Intergenic
1134756550 16:16672485-16672507 GATTTTATCCTAAGTGTGGGGGG + Intergenic
1134801475 16:17088737-17088759 GAATGTATGCTTAATGTGGATGG - Intergenic
1134989519 16:18686678-18686700 GATTTTATCCTAAGTGTGGGGGG - Intergenic
1135171627 16:20189176-20189198 GAAAATGTTCTGAGGGTGGATGG + Intergenic
1135409829 16:22225301-22225323 GATTTTATTATGAATGTGAAAGG + Intronic
1135520743 16:23175787-23175809 GAATTTATTCTGATTTTGCTTGG + Intergenic
1135823067 16:25701833-25701855 GGATTTATTCTAAGAATGGAAGG + Intronic
1135988223 16:27200169-27200191 GAATTTGTTTTGACAGTGGATGG - Intergenic
1137023537 16:35452626-35452648 CAGCTTATTCTGTGTGTGGAAGG - Intergenic
1137730338 16:50684836-50684858 GGATTTACTCTGAATGTGGTGGG - Intergenic
1138200658 16:55085858-55085880 GCTTTTATTCTGAGTGTGGTGGG + Intergenic
1138825544 16:60314937-60314959 TAACCTATTCTGAGTGTGGGAGG - Intergenic
1138898678 16:61241812-61241834 CAATTTATTATGAGTCTGAAAGG - Intergenic
1139098842 16:63740510-63740532 GGATTTATTCTGGGTATGCAAGG + Intergenic
1139622219 16:68154852-68154874 GAATTAGTTCTAAATGTGGAGGG + Intronic
1139921445 16:70463031-70463053 GAAGTTTTTTTGAGTGTAGATGG + Intronic
1141274244 16:82570850-82570872 GAATTTATTGTAAGTATGCAAGG + Intergenic
1144590982 17:16523590-16523612 GAAAATATTCTGAAGGTGGAGGG - Intergenic
1148212548 17:45817231-45817253 AAATTAATTCTGAGAGTGGCAGG - Intronic
1149674663 17:58448575-58448597 TGATGTATTCTGAGTGTTGAAGG + Intronic
1150239207 17:63618695-63618717 GGTTTTATTCTGAGTGTGATGGG + Intergenic
1150472317 17:65447535-65447557 GGATTGATTCTGAGTTTAGAAGG + Intergenic
1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG + Intronic
1150751884 17:67871615-67871637 GAATTTTTTCTGAGTAGAGATGG + Intronic
1150953396 17:69827266-69827288 GACTTTATTCTGATTATGGGAGG - Intergenic
1152981102 18:277608-277630 GATTTTATTCTGGGAGTTGAAGG + Intergenic
1153113150 18:1618763-1618785 GGATTTATTTTGAGTGTGATGGG + Intergenic
1154225901 18:12503698-12503720 GACCTTATTCTGACTCTGGAAGG - Intronic
1154982602 18:21515966-21515988 GATTTCCTTCTGAGTCTGGAGGG - Intronic
1154982610 18:21516023-21516045 GATTTCCTTCTGAGTCTGGAGGG - Intronic
1158494625 18:57943242-57943264 GAATTCAGTCTGAGTGTGGCTGG + Intergenic
1159812706 18:73035679-73035701 GAAATTATTTTTAATGTGGATGG - Intergenic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1163532139 19:17856298-17856320 GAATTTATTTTGGGTGGGTACGG - Intergenic
1164316722 19:24095215-24095237 GAATTTATTCTGGGAATGTAAGG - Intronic
1165396283 19:35565399-35565421 GAGTTTATTCTGAGTGGGAAGGG - Intergenic
1165661324 19:37582950-37582972 GATTTTATTCTAAGTGTGATAGG - Intronic
1166077912 19:40424879-40424901 GATTTTATCCTGAGTGTGGTGGG + Intronic
1167850146 19:52195058-52195080 GCTTTTATTCTGAATGTGCAGGG + Intronic
1168054868 19:53857490-53857512 AAATTTATTCTGAATGTTGGAGG - Intergenic
925207511 2:2019552-2019574 AAATATATTCTCAGTGTGGGGGG + Intronic
925803896 2:7629695-7629717 GAATTTACACTGACTCTGGAAGG - Intergenic
931101742 2:59010074-59010096 GACTTTATTCAGAGTGTGTGAGG - Intergenic
931639991 2:64373549-64373571 AAATTTATTCTGAGTATGGTGGG + Intergenic
931961412 2:67487208-67487230 GATTTTATTCTGAGAGTGACAGG + Intergenic
933056149 2:77668450-77668472 GAAGTTCTTGTGAGTGTGGCTGG + Intergenic
933927647 2:87112433-87112455 GAAGTTCTTGTGAGTGTGGCTGG + Intergenic
935151963 2:100445866-100445888 TAATTTATTCTAAGTATGTAAGG - Intergenic
935503511 2:103870283-103870305 AGATTTATTCTGAGTGTAGCAGG + Intergenic
936692449 2:114906684-114906706 GAATTTATCCTGAGGATGCAAGG - Intronic
936888948 2:117346762-117346784 AAAGTAATTCTGTGTGTGGAAGG + Intergenic
937819471 2:126292843-126292865 GGATTTATTCTGGGTATGCAAGG + Intergenic
939002847 2:136756210-136756232 GAATTTATTCTAAGTGTACTGGG + Intergenic
940001981 2:148975584-148975606 GAATCTATTTAGGGTGTGGAGGG + Intronic
940053763 2:149492138-149492160 TCATTTATTGAGAGTGTGGAGGG - Intergenic
940797441 2:158095432-158095454 GAATTTGATCTGGGTGTTGAAGG - Intronic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
942923025 2:181399902-181399924 GAATTTAGTGTAAGTGAGGATGG - Intergenic
943284887 2:185985114-185985136 GAGTTTATTCTGCATGTGGTAGG - Intergenic
943912286 2:193584190-193584212 GAATTATGCCTGAGTGTGGATGG - Intergenic
943983057 2:194580502-194580524 GAATTTATCCTGAGAATGTAAGG - Intergenic
944670374 2:201989382-201989404 GGGTTTATACTGAGTGTGGTGGG + Intergenic
944835496 2:203575265-203575287 GAATTTATTGTGTGTGTGTGTGG - Intergenic
945179085 2:207073723-207073745 GAAATTTCTCTGAGTGAGGAAGG - Intergenic
946494970 2:220186961-220186983 GCATTTCCTCTGAGTGTTGAGGG + Intergenic
946501726 2:220255711-220255733 GAATTTATTCTGAGAATATAAGG + Intergenic
946546746 2:220752399-220752421 AAACTTACTCTGAGTGTGAATGG + Intergenic
946705590 2:222455552-222455574 GACTTTATTCTGAGTGTGATTGG + Intronic
946950715 2:224871524-224871546 GAATTTATCCTAAGTGTGATTGG - Intronic
947263426 2:228251010-228251032 AAATTTCTTCTGAGTGTCGATGG + Intergenic
948741895 2:240053792-240053814 TACATTGTTCTGAGTGTGGACGG - Intergenic
948742099 2:240054921-240054943 GAAATTATTTAGAGTGTGGAAGG + Intergenic
1169051903 20:2586068-2586090 GAGTGTATTCTGCATGTGGAAGG - Intronic
1169281038 20:4267135-4267157 GAAGTTAATCTGGGAGTGGAGGG + Intergenic
1170187360 20:13605862-13605884 GATTTTATTCTAAGTGTGCTAGG - Intronic
1171983898 20:31645965-31645987 GATTTTATTCTAAGTGTGATGGG + Intergenic
1172047726 20:32092612-32092634 GATTTTATTCTGAGCGTGTTGGG - Intronic
1172121651 20:32602348-32602370 GACTTTATTCTGAGTGAGGTGGG - Intronic
1173403824 20:42747823-42747845 GATTTTATTCTGAGTGTGACAGG + Intronic
1180880062 22:19197301-19197323 GAGGTTAGTCTGAGAGTGGAGGG - Intronic
1181122540 22:20681409-20681431 GATTTTATTCTGAGCTTTGAGGG - Intergenic
1181179883 22:21059676-21059698 GATTTTATTCTGAGCTTTGAGGG + Intronic
1181332322 22:22102880-22102902 TAATTTAATCTGAGTGGAGAGGG - Intergenic
1181713723 22:24708271-24708293 GAATTTTTTCTCAGAGTGGAAGG + Intergenic
1181919539 22:26310134-26310156 GGATTTATTCTGAGGTTGTAGGG - Intronic
1182042704 22:27250709-27250731 GCTTTTATTCTGAGTGGGGTGGG + Intergenic
1182232072 22:28845884-28845906 TAATTTATTTTTAGTGGGGACGG - Intergenic
1185060922 22:48606356-48606378 GAATTTTCTCTGCTTGTGGAAGG - Intronic
949099374 3:125669-125691 GATTTTATTCTAAGTGTGTTGGG + Intergenic
949490512 3:4584586-4584608 GAATTTATTAAGAGTTTGGAGGG + Intronic
950455197 3:13088643-13088665 GTTTTTATTCTGAGTGGGGTGGG - Intergenic
950799748 3:15540623-15540645 GTATTGAATCTGAGTGTTGATGG + Intergenic
951504601 3:23429447-23429469 GGATTTATCCTGGGTGTGCAAGG + Intronic
952727301 3:36600085-36600107 GAATTTATTCTGATTCTTCAAGG + Intergenic
955120777 3:56055916-56055938 GAATTTGATAGGAGTGTGGAAGG + Intronic
955507952 3:59650859-59650881 GATTTTATTCTAAGTGTGAAGGG + Intergenic
955631750 3:60982166-60982188 GACTTTATTCTGAGTGTAGCAGG - Intronic
955860580 3:63325599-63325621 GAATTTACACTGAGTGTAGGAGG - Intronic
956055042 3:65289830-65289852 GTCTTTATTCAGAGTGTAGACGG - Intergenic
956337328 3:68178508-68178530 GAATTAATTCAGAGTGTTCAGGG + Intronic
957467426 3:80612197-80612219 GATTTTATTCTGAGTGAGTTAGG - Intergenic
957768689 3:84659345-84659367 GAACTTTTACTGATTGTGGAAGG - Intergenic
957903668 3:86531295-86531317 GTCTTTATTCTGAGGTTGGATGG - Intergenic
958621517 3:96569106-96569128 GAGTTGATTCTGAGTGATGAAGG - Intergenic
959089649 3:101888497-101888519 GAATTGTTTCTTAGTGTGGTTGG + Intergenic
959528058 3:107399462-107399484 AAATTTATTTTGGGTGTAGAGGG - Intergenic
961336591 3:126183914-126183936 GAATGTATTTTGCATGTGGAAGG + Intronic
962888574 3:139651452-139651474 GAGGTTATTCTGAGAGGGGAAGG + Intronic
962944440 3:140154427-140154449 GACTTTATTCTAAGTGTGGTGGG + Intronic
965725568 3:171711657-171711679 GAATTTGGTGTGAGTGTGGGAGG + Intronic
965858747 3:173121070-173121092 GTATTTATTCTGAATTTGGGAGG - Intronic
967911225 3:194544254-194544276 GAATTGGTTCTTGGTGTGGAAGG - Intergenic
969955030 4:10880357-10880379 GATTTTATTCTGAGTGCAAACGG - Intergenic
970951441 4:21760821-21760843 GAATGCATTGGGAGTGTGGATGG - Intronic
972075842 4:35085962-35085984 GCATTTATTATGAATGTGGATGG + Intergenic
972224654 4:36998489-36998511 GAAGTTGTTATGAATGTGGATGG + Intergenic
972495997 4:39635362-39635384 GATTTTATTCTGAATATGGATGG + Intronic
973105332 4:46328810-46328832 GAATTTATGTTTAGTATGGATGG - Intronic
974898045 4:67963068-67963090 GATTTTTTTGTGTGTGTGGAAGG - Intronic
975116367 4:70685641-70685663 GCATTTATTCTGGGTGTTGGAGG - Intronic
975271541 4:72440776-72440798 GAAATTATTTTGATTATGGATGG - Intronic
976462042 4:85322882-85322904 GGAATTATTCTTAATGTGGAAGG + Intergenic
976748618 4:88431178-88431200 AAATTTGTCCTGAGTCTGGAGGG + Exonic
976964392 4:91017997-91018019 GATTTGATTCTGAATGTGGATGG + Intronic
977047107 4:92081033-92081055 GAATTTCTTCATAGTGTTGATGG - Intergenic
977400714 4:96528262-96528284 GAATTAATTATGAATGTGGTGGG + Intergenic
978432786 4:108650905-108650927 GGATCTTTTCTGAGGGTGGAGGG + Intronic
978631091 4:110745641-110745663 GAATTTATTCTAGGTATGCAAGG - Intergenic
979263209 4:118671799-118671821 GATTTTATTTTAAGTGTGAATGG + Intergenic
979265456 4:118696890-118696912 GAATATATTCTGGGTGTACATGG + Intronic
979342672 4:119545385-119545407 TAAATTATTCTGAGTTTGTATGG - Intronic
979528337 4:121741079-121741101 GGCTTTATTCTGAGTGTGATGGG - Intergenic
981909582 4:149963573-149963595 AAAATTATTCTGAGTTAGGAAGG + Intergenic
983008202 4:162511881-162511903 GTGTTAATTCTGAGTTTGGAAGG + Intergenic
983571665 4:169215281-169215303 GAATTTATCCTAAGTATGCAAGG - Intronic
983887858 4:173000971-173000993 GAGATTATTCTGAGTATGGTGGG + Intronic
987665967 5:20940058-20940080 GAATTTAGTCTGGGTATAGATGG + Intergenic
987977573 5:25034042-25034064 GAATTTAATCTGATTTTGAAGGG - Intergenic
988455908 5:31387036-31387058 GAATATATCCTGGGTGTGGAAGG - Intergenic
988756720 5:34262121-34262143 GAATTTAGTCTGGGTATAGATGG - Intergenic
988967489 5:36433897-36433919 GGTTTTATTCTGAGTGAGGTGGG - Intergenic
989558064 5:42820061-42820083 GAATTTATTCTTAGAGGGCATGG + Intronic
990287932 5:54318642-54318664 GAATTTATTCCGATTGATGAAGG + Intergenic
990865655 5:60376885-60376907 CAATTTAGACTGAGTGTTGAAGG - Intronic
992450169 5:76869204-76869226 GAACTCATTCAAAGTGTGGAGGG + Intronic
992590112 5:78286024-78286046 GATTTTACTCTGAGTGAGAAGGG - Intronic
992987028 5:82241427-82241449 GATTTTATTCTGAGTGTGATGGG - Intronic
993719666 5:91309999-91310021 GAATTGATTCTGAGAGTAAAAGG - Intergenic
993799079 5:92307594-92307616 AAATTTCTTCTAAGTGTGCAAGG + Intergenic
993903399 5:93598903-93598925 GCATTTATTGTGTGTGCGGAAGG + Intergenic
994896745 5:105715106-105715128 GAATTTATTCCCAGTGTGCAAGG + Intergenic
994966003 5:106671767-106671789 CAATTTGTTCTGAGAGTGAAAGG + Intergenic
995656321 5:114430922-114430944 GAATTTATTCTGAGCATACAAGG - Intronic
996190474 5:120534643-120534665 CAACTTATGCTGAGTGTGTAAGG - Intronic
998206680 5:140162287-140162309 AATTTTATTCTGAGTGTGATGGG - Intergenic
998396286 5:141820597-141820619 GAAGTTTTTCTGTGTGTGTATGG + Intergenic
998527873 5:142859062-142859084 GGATTTATTTTGAGTGGGGTGGG + Intronic
998881404 5:146648949-146648971 GATTTTATTCTGAGTTTAGTGGG + Intronic
999069958 5:148733972-148733994 GAATTTATTCTGAGTGCAAAGGG - Intergenic
999439278 5:151589150-151589172 GGATTCATTTTGAGTGGGGAAGG - Intergenic
999642615 5:153687076-153687098 ACATTTACTTTGAGTGTGGAAGG - Intronic
999653311 5:153788445-153788467 CATTTTATTCTGAGATTGGAGGG - Intronic
1000471660 5:161650321-161650343 GAATTGATTCTGTGTATGGTTGG + Intronic
1004541281 6:16552841-16552863 GAATTTAGTATGAGTGTGAGTGG - Intronic
1004987625 6:21100582-21100604 GAAATTATTGTGAGGGTGGCAGG - Intronic
1005912671 6:30325166-30325188 GATTTTATGCTGAATATGGAAGG - Intergenic
1005995253 6:30926917-30926939 GAATGTACTCTGGGCGTGGAAGG - Intergenic
1006664509 6:35682288-35682310 GAATATATTCTGAATGAGCATGG - Intronic
1006868965 6:37232995-37233017 GCATTTGTTCTCAGTGTAGATGG - Intronic
1009051880 6:58285156-58285178 GGATTTATTCTGAGAATGCAAGG + Intergenic
1009687414 6:66980908-66980930 GAATTTATTGTAAGCCTGGAAGG + Intergenic
1010285923 6:74077686-74077708 GAAAATATACTGAGTGTGAAGGG + Intergenic
1010361263 6:74997201-74997223 GATTTTATTCTGAGTCTAGTAGG - Intergenic
1010876108 6:81107914-81107936 GAATTTATTATCAGTATTGAAGG + Intergenic
1012086462 6:94832019-94832041 CATTTTATTTTGGGTGTGGAAGG - Intergenic
1012154292 6:95797370-95797392 GAATTTAATCTGAGTAGGGATGG + Intergenic
1013733135 6:113193221-113193243 GAATTTATTCTAAGTATGCAAGG + Intergenic
1014178743 6:118359992-118360014 GAATTTATTCTAGGTATGTATGG + Intergenic
1014759861 6:125344603-125344625 GATTTTATTCTGAGGTTTGATGG + Intergenic
1019496997 7:1345414-1345436 GAGTTCATTCTTAGTGAGGAGGG + Intergenic
1020351473 7:7224082-7224104 GAGTTTATTCTGAGTATGTAAGG - Intronic
1020871349 7:13633121-13633143 GAATTTATTCTGTGTCTTCAGGG + Intergenic
1022889184 7:34678169-34678191 GCATTTTTTCTGAGCCTGGATGG - Intronic
1024803353 7:53107147-53107169 GAATTTACTCTGAGTGAGATGGG + Intergenic
1027301520 7:76841789-76841811 GAATTTATTCCAAGTGTACAAGG + Intergenic
1027566416 7:79800444-79800466 AAATTTATTCTGGCTGTGCATGG + Intergenic
1028332085 7:89607347-89607369 GAGATGATGCTGAGTGTGGAAGG - Intergenic
1028653563 7:93176220-93176242 GGATTTATTCTGAATATGAAAGG + Intergenic
1030497128 7:110314357-110314379 AAGTTTATTCTGAGTGTGCTGGG - Intergenic
1030510673 7:110479136-110479158 GATTTTATTCTGAATGTGCTAGG - Intergenic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1033674116 7:143520786-143520808 GGCTTTATTCTGAGTGTGATGGG + Intergenic
1034235466 7:149564947-149564969 GTATTTTTTGTGAGTGTGTAAGG - Intergenic
1038433280 8:27516583-27516605 GTATTCATTCAGAGTGTGGGGGG - Intronic
1038700498 8:29845331-29845353 GATTTTGTTCTTTGTGTGGACGG + Intergenic
1039440290 8:37590508-37590530 GAATATTTTATGAGTGTGCATGG - Intergenic
1041256012 8:55980122-55980144 GACTTGATTATGAGTGAGGAGGG - Intronic
1041296688 8:56363776-56363798 GGATTTATCCTGGGGGTGGAAGG + Intergenic
1042220871 8:66472547-66472569 GCATTTATTCTGAGAGTGATTGG - Intronic
1042492404 8:69414867-69414889 GAATTAATACTATGTGTGGATGG + Intergenic
1043378068 8:79672036-79672058 GAATTTAATCTGGGTAAGGAGGG - Intergenic
1043983229 8:86664618-86664640 GGATTTATTCTCAGTGTTGAGGG - Intronic
1044807194 8:96020619-96020641 GAATTTAGTCTGAGAATGTAAGG + Intergenic
1045311470 8:101007126-101007148 GAATTTATTCAGAGTGAGGGAGG + Intergenic
1045707640 8:104944781-104944803 GACTTGATTCTAAGTGTGCAGGG - Intronic
1047939887 8:129819367-129819389 AACTTTAATCTGGGTGTGGAGGG - Intergenic
1048834684 8:138507551-138507573 CAGTTTCTTCTGAGTATGGAGGG + Intergenic
1051337014 9:16074879-16074901 GACTTTATTCTGAGGGTGGCAGG + Intergenic
1051552118 9:18341473-18341495 ACATTTATTCTGGATGTGGAAGG - Intergenic
1052352979 9:27476003-27476025 GTTTTTATTCTGAGTGTGATGGG - Intronic
1052549228 9:29926728-29926750 GAGTTTATTTTGCATGTGGAAGG - Intergenic
1055349186 9:75367883-75367905 ACATTTATTATCAGTGTGGATGG + Intergenic
1056077485 9:83056367-83056389 ATATTTATTCTGAGTGTTCAGGG - Intronic
1056730309 9:89160315-89160337 GGATTTATTCTGGGTCTGGAAGG - Intronic
1056802700 9:89704153-89704175 CAATTCATTCTGAGTTTGAAAGG - Intergenic
1056876363 9:90336595-90336617 GAATTTATTCTAGGTATGCAGGG + Intergenic
1057250819 9:93500225-93500247 GAATTTATTCCAAGTGTGACGGG - Intronic
1057569182 9:96190850-96190872 GATTTTATTCTGTGTGTGGTGGG - Intergenic
1058441194 9:105008899-105008921 GGTTTTATTCTAAGTGTGGTAGG + Intergenic
1058624535 9:106921118-106921140 GTATGTCTTCTGTGTGTGGAAGG + Intronic
1059042733 9:110831279-110831301 TAATTTATTCTGAGAATGAATGG + Intergenic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1060772944 9:126346071-126346093 GCAATTATTCTGAGGGTGGTGGG + Intronic
1061471909 9:130833969-130833991 GAATTTATTCTTGATGTGAAGGG + Intronic
1185659091 X:1712487-1712509 ATATTTATTCAGAGTGTAGAAGG + Intergenic
1187519491 X:20001196-20001218 GAAATTATTCAGAATGTGAAAGG - Intergenic
1187899588 X:24015078-24015100 GAATTTATTCTAAGAATGTAAGG - Intronic
1188185009 X:27103006-27103028 GAATTTACTCTGAGTGAAGTTGG - Intergenic
1188275704 X:28198094-28198116 GAATTTATTCTAAGTGTGGAAGG - Intergenic
1188376576 X:29437747-29437769 GAGTTTATTCTTAGGATGGAAGG - Intronic
1189183181 X:39023705-39023727 GGATTTATTCTAAGTATGCAAGG - Intergenic
1190876438 X:54463567-54463589 GATTTTATTCTGAGTATGGTGGG - Intronic
1191709957 X:64139212-64139234 GATTTTATTCTGAATGTGATGGG - Intergenic
1191853663 X:65605352-65605374 GGATATATTCTGAGTGTAGCAGG - Intronic
1193043318 X:77026230-77026252 GATTTTATTCTGAGTGAGATTGG + Intergenic
1193787618 X:85778793-85778815 GAATTTAAGCTGAGTGAGTAGGG - Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1195152084 X:102082350-102082372 GATTGTATTGTGACTGTGGAAGG - Intergenic
1195227714 X:102815419-102815441 GGTTTTATTCTGAGTGTGGAAGG + Intergenic
1195294496 X:103462388-103462410 GATTGTATTGTGAGTGTGGAGGG + Intergenic
1195307860 X:103603364-103603386 GAATTTACTCTGTGGGTGGTAGG + Intergenic
1196777042 X:119347958-119347980 GATTTTACTCTGAGTGACGATGG + Intergenic
1197617752 X:128714082-128714104 GATTTTATTCTGAGTGAGACAGG - Intergenic
1197948448 X:131866781-131866803 GAATTTATTCCAAGTAAGGAAGG - Intergenic
1198681274 X:139185150-139185172 GCAGTTATTGTGAGTGTGGTTGG - Intronic
1199707353 X:150440206-150440228 GAGTTTATTCTTGGTGTGCAAGG - Intronic
1199775177 X:151004563-151004585 GAATGTATTTTGCTTGTGGAAGG - Intergenic
1200413030 Y:2880154-2880176 AAATTAAATCTGAGTTTGGATGG + Intronic