ID: 1160241310

View in Genome Browser
Species Human (GRCh38)
Location 18:77124994-77125016
Sequence GAGCCGGGACCTCAGAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160241310 Original CRISPR GAGCCGGGACCTCAGAGGAG TGG (reversed) Intronic
900165980 1:1244545-1244567 GAGCTGGGACCCCAGGGCAGCGG + Intronic
900380466 1:2381572-2381594 GGGCCTGGACGGCAGAGGAGTGG + Intronic
900491716 1:2952575-2952597 GAGACTGGGGCTCAGAGGAGAGG + Intergenic
900583196 1:3419321-3419343 CAGCCGGCTCCTCAGATGAGAGG - Intronic
900592240 1:3465299-3465321 GTGCTGGGAGCACAGAGGAGGGG + Intronic
900626713 1:3611732-3611754 GGGCCGGGACCGGAGAGGGGAGG - Intergenic
900711766 1:4119031-4119053 CAGCCGGGACCCGTGAGGAGGGG - Intergenic
901065596 1:6492760-6492782 GATCCTGGAGCTCAGAGGTGTGG + Intronic
901510974 1:9717904-9717926 GATCCGGGACCGCAGAGCTGGGG + Intronic
902373152 1:16017736-16017758 GATCCGGGCCCTGAGGGGAGGGG - Intronic
902702347 1:18181123-18181145 GAGCCGGGGACTAGGAGGAGGGG - Intronic
903141998 1:21344710-21344732 GTGATGGGTCCTCAGAGGAGGGG - Intronic
903461590 1:23524710-23524732 GTGCCTGGGCCTCAGAGGATGGG - Intronic
903663024 1:24990199-24990221 GAGCCTGGAGGTCAAAGGAGGGG + Intergenic
903827428 1:26156182-26156204 GAGCCAGGACCTCAGGCAAGGGG - Intergenic
904424062 1:30412359-30412381 GAGCCAAGACCTGTGAGGAGAGG + Intergenic
904532977 1:31181485-31181507 CAGCCCGGACTTCGGAGGAGTGG - Exonic
904948423 1:34216172-34216194 GAGTCTGGAACTCAGGGGAGAGG + Intronic
904966613 1:34379101-34379123 GAGTCGGCCCCTCACAGGAGAGG - Intergenic
905651612 1:39660722-39660744 GGGCAGGGACTTCAGAGAAGAGG + Intronic
905898786 1:41566994-41567016 GAGCCTGGCCCTCAGAGGAGAGG - Intronic
906258702 1:44369731-44369753 GACCCGAGACCTCTGAGAAGGGG + Intergenic
907233721 1:53025413-53025435 GAGTCTGGAGCTCAGTGGAGAGG - Intronic
907316163 1:53574126-53574148 GAACCAGGACCACAGAGGTGTGG - Intronic
907316423 1:53575534-53575556 CAGGCAGGAGCTCAGAGGAGGGG - Intronic
907395989 1:54190191-54190213 AAGTAGGAACCTCAGAGGAGTGG + Intronic
908600626 1:65735329-65735351 GAGCCTGGAGTTCAGAGGAGTGG - Intergenic
909513104 1:76477360-76477382 GGGCCAGGACCTCAGCTGAGAGG - Intronic
910431923 1:87167538-87167560 GAGCTGGGCCCTGAGAGGAAAGG - Intronic
912775800 1:112505795-112505817 GAACTGGGGACTCAGAGGAGAGG + Intronic
913076300 1:115343270-115343292 GAATCGGGACAGCAGAGGAGAGG - Intergenic
913343086 1:117779853-117779875 GAGTCAGCAGCTCAGAGGAGAGG - Intergenic
915623296 1:157099133-157099155 GAGCCGGGCCCTCAGGTGAGAGG - Exonic
916021619 1:160797369-160797391 GAGCCTAGACCTCAGAGCTGAGG + Intronic
916191198 1:162180015-162180037 GAGCCTGGATCTGAGAGGTGAGG + Intronic
917527579 1:175802564-175802586 GAGCCCTGTCCTCAGAGGTGAGG + Intergenic
917565318 1:176206996-176207018 CAGCCGGGCGCTCGGAGGAGAGG + Exonic
919587933 1:199462790-199462812 GAGCTGGGACCTCAGCTGAGGGG - Intergenic
919639312 1:200033903-200033925 GTGCCGGGACCGCAGAGGTGCGG - Intronic
919884206 1:201920946-201920968 GAGCAGTGAACACAGAGGAGTGG + Intronic
920006102 1:202834992-202835014 GCCCTGGGAGCTCAGAGGAGGGG - Intergenic
920159699 1:203986937-203986959 AAGTCAGGAGCTCAGAGGAGAGG + Intergenic
920366979 1:205453352-205453374 GAGATGGGACCTCGGAGCAGAGG - Intronic
924626378 1:245699218-245699240 GGGCCGGGACAGCAGAGGGGTGG + Intronic
1062823385 10:551172-551194 GAGCCGAGACCTGCAAGGAGGGG - Intronic
1065980648 10:30892661-30892683 GAGCCGTTGCCTCTGAGGAGGGG - Intronic
1067433789 10:46263657-46263679 GAACAGGGAGGTCAGAGGAGAGG - Intergenic
1067998925 10:51308876-51308898 GAGCTGAGACCTTTGAGGAGGGG + Intronic
1069599244 10:69692797-69692819 GAGCCAGGACCTCTCTGGAGAGG + Intergenic
1069599396 10:69693766-69693788 GAGCCAGGACCTCTCTGGAGAGG - Intergenic
1069657673 10:70102148-70102170 GAGCCACGACCTCAGCGTAGGGG + Intronic
1070696893 10:78570393-78570415 GAGCAGGGACCTGAGGAGAGTGG - Intergenic
1070764657 10:79049312-79049334 GGGCCTGGACCTGAGGGGAGGGG + Intergenic
1073208856 10:101782678-101782700 GAACCGGGACCTCTGAGGCTGGG - Intronic
1075065990 10:119289223-119289245 GAGCAGGGGCCACAGAGAAGTGG - Intronic
1075452611 10:122562456-122562478 GGCCCAGGACCTCAGGGGAGTGG + Intronic
1077138610 11:1013726-1013748 GAGCCGGGAGCTCAGCGGGGAGG - Intronic
1077500442 11:2907659-2907681 GAGTCGGGAACTCAGAGGCAGGG + Intronic
1077506300 11:2931380-2931402 GTGCTGGGACCCCAGAGGAGGGG + Intergenic
1077893007 11:6432939-6432961 GAGCCTAAACCTCAAAGGAGAGG - Intronic
1078130545 11:8610636-8610658 GAGTCTGGAGCTCAGAAGAGTGG + Intergenic
1078847898 11:15138056-15138078 GAACAGGGAGCCCAGAGGAGAGG + Intronic
1079321190 11:19453148-19453170 GAGAGGGGAACTCAGAGCAGTGG - Intronic
1080689572 11:34545164-34545186 GAGTCTGGACCTCAGAAGAAAGG + Intergenic
1081749710 11:45501333-45501355 GAGACGGGGCCACAGAGGGGTGG - Intergenic
1081805987 11:45890820-45890842 GGGTCTGGAGCTCAGAGGAGAGG + Intronic
1084311093 11:68316806-68316828 GTGCTGGCATCTCAGAGGAGGGG + Intronic
1085219854 11:74864757-74864779 GAGCAGGGACCTCAGCTGAGAGG - Intronic
1087076775 11:94133164-94133186 GGGCCAGAACCTCTGAGGAGTGG - Intronic
1089271014 11:117301255-117301277 GCGTCGGGAGCTCAAAGGAGAGG - Intronic
1089292198 11:117444108-117444130 GTGCCCGGGGCTCAGAGGAGAGG + Intronic
1089529293 11:119116245-119116267 GAGCTGGGTCCTCAGAGCTGGGG - Exonic
1089580717 11:119480563-119480585 GAGTGTGGAGCTCAGAGGAGAGG - Intergenic
1090347447 11:126082795-126082817 CAGCCGGGACCTCAATGGCGGGG + Intergenic
1093926276 12:24911418-24911440 GAGCAGGGTCCTGAGGGGAGAGG - Intronic
1093957379 12:25236412-25236434 GAACTGGAAGCTCAGAGGAGGGG - Intronic
1094525235 12:31226942-31226964 GGGCTGGGGCCTCTGAGGAGTGG - Intergenic
1095088295 12:38082297-38082319 ATGCAGAGACCTCAGAGGAGTGG - Intergenic
1102949487 12:117020754-117020776 GAGCTGCGACTTCAGGGGAGGGG - Intronic
1102957054 12:117065555-117065577 GAGTCAGGAGCTCAGGGGAGAGG + Intronic
1104746437 12:131213965-131213987 GCGCAGGGACCTCAGAGGTGGGG - Intergenic
1105577521 13:21667970-21667992 GAGCTGGGACCCGTGAGGAGAGG + Intergenic
1106506370 13:30373941-30373963 GAGCTGAGAGCTCAGAGGAAGGG - Intergenic
1107041531 13:35953631-35953653 AGGCCGGAAGCTCAGAGGAGAGG - Intronic
1107398204 13:40040878-40040900 GAGGATGGAGCTCAGAGGAGAGG + Intergenic
1108610072 13:52076742-52076764 GAGTCTGGAGCTCAGAGGAGAGG - Intronic
1109203745 13:59459178-59459200 CAGCTGGAGCCTCAGAGGAGAGG - Intergenic
1112207330 13:97337592-97337614 GAGCCTGGGGCTCAGAGGAGAGG - Intronic
1113107805 13:106790323-106790345 GAGCCTGGATCTCAAAGGAGAGG - Intergenic
1113518884 13:110924212-110924234 GAGTCTGGAGCTCAGAGGAGAGG - Intergenic
1113841211 13:113362859-113362881 GAGCTAGGAACTCAGAGAAGTGG - Intronic
1114536320 14:23425234-23425256 CAGCCTGGGCCTCAGAGAAGCGG + Intronic
1120509966 14:85401309-85401331 AAGCCGGGCACTCAGAGCAGAGG + Intergenic
1121410203 14:93744297-93744319 GAGCAGGCACCGCAGAAGAGTGG - Intronic
1121640123 14:95479739-95479761 GCCACGGGACCTCAAAGGAGTGG + Intergenic
1121738658 14:96236285-96236307 GGGTCTGGAGCTCAGAGGAGGGG - Intronic
1121820535 14:96962264-96962286 GAACCCAGACCTCTGAGGAGCGG + Intergenic
1122129233 14:99595598-99595620 GTGCTGGGAGCTCAGAGGAGGGG - Intronic
1122601175 14:102922734-102922756 GAGCCGGGACCACACCGGTGCGG + Intronic
1122738745 14:103858654-103858676 GAGCCGGCCCGTCAGGGGAGGGG - Intergenic
1123174238 14:106401719-106401741 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1123182450 14:106482654-106482676 GAGCCTTGACCTCAAAGCAGCGG - Intergenic
1202944452 14_KI270726v1_random:14075-14097 GAGCCTTGACCTCAAAGCAGCGG + Intergenic
1123500655 15:20878206-20878228 GATTCGGGATCCCAGAGGAGAGG - Intergenic
1123557900 15:21451899-21451921 GATTCGGGATCCCAGAGGAGAGG - Intergenic
1123594129 15:21889180-21889202 GATTCGGGATCCCAGAGGAGAGG - Intergenic
1129287616 15:74538905-74538927 GAGCTTGAACCTGAGAGGAGAGG - Intergenic
1129691097 15:77714040-77714062 AAGCCTGGAGCTCAGGGGAGAGG - Intronic
1131521473 15:93119303-93119325 CAGCCGGGACTTCAGAAGAGGGG + Intergenic
1131718288 15:95137782-95137804 TCGAAGGGACCTCAGAGGAGTGG + Intergenic
1132256583 15:100381745-100381767 GTGCTGGGACCTCTGAGAAGAGG - Intergenic
1202966251 15_KI270727v1_random:179071-179093 GATTCGGGATCCCAGAGGAGAGG - Intergenic
1133816673 16:9202983-9203005 GTGCCAGGAGCACAGAGGAGGGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136629716 16:31482893-31482915 GAGCCTGGAGCACAGGGGAGAGG + Intergenic
1137787666 16:51151666-51151688 GCGCCGGGCCCGCAGTGGAGAGG - Intergenic
1138010197 16:53372453-53372475 GAGCCAGGAACTCAAGGGAGAGG + Intergenic
1138340664 16:56287074-56287096 CACCTGGGACCTCAGGGGAGAGG - Intronic
1138708104 16:58938549-58938571 GAACAAGGAGCTCAGAGGAGGGG - Intergenic
1139420177 16:66844940-66844962 GAGCGGGGACCTCGGGGGAGCGG + Intronic
1139490545 16:67283740-67283762 GGGCCTGGAGCTCAGAGGAGAGG + Intronic
1139497108 16:67327582-67327604 GGGTCTGGACCTCAGAGGAGAGG + Intronic
1141075949 16:81006863-81006885 GAGCCGGGAGCACGGTGGAGCGG - Exonic
1141202747 16:81910443-81910465 CAGCCAGGGCCTCAGAGGCGGGG - Intronic
1141802972 16:86323565-86323587 GAGCCAGGAACTCAGAGGCTTGG - Intergenic
1141946913 16:87317030-87317052 GGGCCGGGAACTCACAGGCGAGG + Intronic
1141990815 16:87608501-87608523 GAGCCAGGACCCCAGTGCAGCGG - Intronic
1142994126 17:3750950-3750972 GAGCTGGGACCGCAGGGGTGGGG + Intronic
1143633023 17:8149537-8149559 GAGCCAGGAGCTCAGAGAAGCGG + Exonic
1146178161 17:30679733-30679755 GAGCGGGGAGGACAGAGGAGGGG + Intergenic
1146658415 17:34648893-34648915 GAGAAGGGCCCTCTGAGGAGGGG - Intergenic
1147459308 17:40558163-40558185 GAGGTGGGAGCTCAGAGTAGGGG - Intronic
1148085763 17:44992985-44993007 GAGACAGGACCTGAGATGAGAGG - Intergenic
1149490609 17:57082483-57082505 AAGTCTGGAGCTCAGAGGAGTGG - Intergenic
1150225472 17:63522642-63522664 GGGCCTGGTCCTGAGAGGAGGGG - Intergenic
1151315448 17:73319102-73319124 GACCCGGGCTCTCAGGGGAGAGG - Intergenic
1151965628 17:77429781-77429803 GACTCGGGACCACAGAGGGGTGG + Intronic
1152128391 17:78461136-78461158 GAGCCTGGTCCTCAGACGTGCGG - Intronic
1152600391 17:81259331-81259353 GAGCCGGGGCCTCTGCAGAGGGG + Intronic
1152740397 17:82016107-82016129 GCGCCGGGACCACCGTGGAGGGG - Intronic
1153061707 18:1001773-1001795 AAGTCTGGAGCTCAGAGGAGAGG + Intergenic
1154141328 18:11826831-11826853 GAGCCTGGAGCTCGGAAGAGAGG + Intronic
1154292958 18:13126732-13126754 GAGTCAGGAGCTCAGAAGAGAGG - Intergenic
1154978940 18:21486374-21486396 GAGGCCGGAGCTCAGAGAAGTGG - Intronic
1155100747 18:22607734-22607756 CAGCCGGGACCTCAGAGAGCAGG - Intergenic
1156214080 18:34978002-34978024 GAGCCGTAACCTCGGAGAAGGGG + Intronic
1156631566 18:38975609-38975631 GTGTGGTGACCTCAGAGGAGTGG + Intergenic
1157359509 18:46964555-46964577 GAGCTGGGTCCTCGGAGCAGCGG + Intronic
1157361103 18:47024074-47024096 GAGCTGGGTCCTCGGAGCAGCGG + Intronic
1157362093 18:47029989-47030011 GAGCTGGGTCCTCGGAGCAGCGG + Exonic
1160221412 18:76980532-76980554 CACCCGGGACCACAGAAGAGGGG - Intronic
1160241310 18:77124994-77125016 GAGCCGGGACCTCAGAGGAGTGG - Intronic
1160362843 18:78298345-78298367 GAGAGGGGACCTACGAGGAGGGG - Intergenic
1161682446 19:5686997-5687019 GGGCCGGGGCCGCGGAGGAGCGG - Intronic
1162980421 19:14235706-14235728 GAGCAGGGAGGACAGAGGAGCGG - Intergenic
1163157970 19:15449515-15449537 GACCCTGGACCCCCGAGGAGTGG - Intronic
1163728154 19:18934130-18934152 CAGCAGGGACCACAGAGGAGTGG - Intronic
1164226562 19:23251229-23251251 GGGCCTGGACATCAGAGGTGGGG + Intergenic
1165155186 19:33782545-33782567 GATCTGGGACCACAGAGAAGTGG + Intergenic
1165741519 19:38207714-38207736 GGTCAGGAACCTCAGAGGAGGGG + Exonic
1165793790 19:38507161-38507183 CAGGCGGGACCAGAGAGGAGAGG + Intronic
1165808632 19:38596994-38597016 GTGCTGGGAACTCTGAGGAGTGG - Intronic
1165932235 19:39367204-39367226 GAGCTAGGACCCCAAAGGAGTGG - Intronic
1166076622 19:40417501-40417523 GGGCCGGGAGCTCAGGAGAGAGG - Intergenic
1166297651 19:41896865-41896887 GAGCGGGGAGGTGAGAGGAGGGG - Intronic
1166853005 19:45769285-45769307 GAGCCGGGAATTCCGAGGGGCGG - Intergenic
1167687543 19:50966084-50966106 GACTCTGGAGCTCAGAGGAGAGG - Intronic
1168125166 19:54278842-54278864 GGGCCGAGCACTCAGAGGAGAGG + Exonic
1168725471 19:58579030-58579052 TTGCCGGGAGCTTAGAGGAGGGG - Intergenic
925759628 2:7171880-7171902 GACCAGTGACCTTAGAGGAGAGG + Intergenic
926493215 2:13551301-13551323 GAGCTAGGATCTCAGAGTAGTGG + Intergenic
926934391 2:18072580-18072602 GGGCCAGGAGCCCAGAGGAGGGG - Intronic
927603266 2:24463074-24463096 GAGTCTGAAACTCAGAGGAGAGG + Intergenic
927657217 2:24959400-24959422 GGTCTGGAACCTCAGAGGAGAGG - Intronic
929450870 2:42036184-42036206 GAGCCAGGCCCTCAGAACAGTGG + Intergenic
931150269 2:59565248-59565270 TAGCAGGGAGCCCAGAGGAGAGG - Intergenic
931674623 2:64682125-64682147 GAGACTGGACTTCAGAGGAGAGG - Intronic
931988236 2:67761881-67761903 GGTCAGGGACCCCAGAGGAGAGG - Intergenic
932556057 2:72825766-72825788 GTGCCGGGACCACAGAGGGGCGG - Intronic
932750433 2:74368151-74368173 GAACCTGGGCCTCAGAGCAGAGG + Intronic
933768653 2:85729115-85729137 GTCCCGGGACCTCAGCCGAGTGG - Intergenic
934573416 2:95385614-95385636 GAGCAGGGCCCTCAGAGGAAAGG + Exonic
934619438 2:95795083-95795105 GAGCCTGGAGCTCAGAAGAGAGG + Intergenic
934641452 2:96029474-96029496 GAGCCTGGAGCTCAGAAGAGAGG - Intronic
937309186 2:120891668-120891690 TAGCCGGCTCCCCAGAGGAGAGG - Intronic
937413814 2:121698654-121698676 TTGCCAGGACCTGAGAGGAGAGG + Intergenic
939194450 2:138954816-138954838 CACTAGGGACCTCAGAGGAGTGG - Intergenic
946027015 2:216678083-216678105 GAGCCTGGAGCTCAGGGCAGGGG + Intronic
947637595 2:231687937-231687959 GAGCCGGGCACTGAGAGAAGGGG - Intergenic
947745971 2:232507562-232507584 GAGAGGGGTCCTCAGAGCAGAGG - Intergenic
947840797 2:233206730-233206752 GAGTCGGGAGCCCAGAGGAACGG + Exonic
948469470 2:238167859-238167881 GAGTCAGCACCTCAGAGGGGAGG - Intronic
948608974 2:239155019-239155041 CAGCTGTGACCTCAGAGGAGTGG - Intronic
948893480 2:240917896-240917918 GGGCCGGGACCCCAGGGCAGGGG - Intergenic
948894178 2:240920637-240920659 CCGCTTGGACCTCAGAGGAGAGG + Intronic
949046112 2:241873408-241873430 GGGGCGGGGCCTCAGAGGCGGGG - Exonic
1169257178 20:4108531-4108553 GAGCTGTGACCTCAGAAGGGAGG - Intergenic
1170292438 20:14785574-14785596 GGGCTGGGGCATCAGAGGAGCGG - Intronic
1170750116 20:19137922-19137944 CAGCAGGGTCCTCTGAGGAGGGG + Intergenic
1173642432 20:44613429-44613451 GAGGCTGGAGCTCAGAAGAGAGG - Intronic
1173713307 20:45179326-45179348 GAGCTGGGACCTCAGCTGATGGG + Intergenic
1174055928 20:47798480-47798502 GAGACCGGAACTCAGAGGAGAGG - Intergenic
1174562220 20:51439477-51439499 GTGGCTGGAACTCAGAGGAGAGG - Intronic
1175284545 20:57829169-57829191 GAGCCGGGGCCACACTGGAGAGG - Intergenic
1175360459 20:58406165-58406187 GAGTCTGGAGCTCAGGGGAGAGG + Intronic
1175439485 20:58981001-58981023 GAGCCGGCGCCGCAGGGGAGGGG + Intergenic
1176255387 20:64149396-64149418 GAGCCGGGACCTTAGAGTCTGGG + Intergenic
1179628401 21:42661455-42661477 GTGCGGGGACCTCACAGAAGTGG + Intronic
1180023810 21:45147027-45147049 GTGCCGTGACCCCTGAGGAGGGG - Intronic
1180068235 21:45423499-45423521 GAGCCGGGCCCTCCGGGGGGCGG - Intronic
1180189297 21:46154936-46154958 GAGCCTGGACCTCAGGGCTGTGG + Intronic
1181078273 22:20395674-20395696 GTGCTGGGAGCTCTGAGGAGTGG + Intronic
1183702422 22:39457780-39457802 GACCGGGGAGCTCGGAGGAGCGG - Intronic
1183745808 22:39691094-39691116 CAGCCTGAGCCTCAGAGGAGAGG + Intergenic
1183789569 22:40055127-40055149 GAGCCAGGACTACAGAGGTGGGG + Intronic
1183987625 22:41578174-41578196 GAGCTGGGACCTGAGCCGAGTGG + Intronic
1184452151 22:44589578-44589600 GAGCTGTCACTTCAGAGGAGAGG + Intergenic
1184571429 22:45327469-45327491 GAGCCGTGACCTCAGTGCTGTGG + Intronic
1185290786 22:50026294-50026316 CAGCCGCCACCTCAGAGGGGAGG + Intronic
949879367 3:8649496-8649518 GAGTCAGGAGTTCAGAGGAGAGG - Intronic
949949948 3:9220947-9220969 GAGGTGGGACCTGAGAGGATGGG - Intronic
950119818 3:10474353-10474375 GAGTTGGGAGCTCAGAAGAGAGG + Intronic
950262624 3:11553758-11553780 GAGCTGGGTCCTCAGGAGAGAGG + Intronic
951790915 3:26483770-26483792 CAGCATTGACCTCAGAGGAGGGG - Intergenic
953179556 3:40583156-40583178 GAGGTGGGAGCTCAGAGCAGGGG + Intergenic
955665244 3:61343298-61343320 GTGCAGGGACAGCAGAGGAGTGG + Intergenic
956763644 3:72465431-72465453 AAGAAGGGACCACAGAGGAGGGG + Intergenic
960593679 3:119389250-119389272 GAGCCTGGAGCTGACAGGAGAGG + Intronic
961208982 3:125110610-125110632 GAACCAGGAACTCTGAGGAGGGG - Intronic
968712055 4:2126557-2126579 GAGCAGAGACCAGAGAGGAGCGG + Intronic
968804497 4:2763612-2763634 GAGCCGGGACCCCTGTGTAGGGG - Intergenic
968878816 4:3288274-3288296 GAGCTGGGCCCTGACAGGAGGGG + Intergenic
969726732 4:8922639-8922661 GAGCTGGGACCTCAGCTGAAGGG - Intergenic
969867505 4:10085244-10085266 AAGCCCTGAGCTCAGAGGAGAGG - Intronic
970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG + Intronic
971426379 4:26520057-26520079 GAGCTGGGAACTCAGAGCAGAGG - Intergenic
976195525 4:82528321-82528343 GAGCCAGAACTTCAGAGGTGGGG - Intronic
977694484 4:99950599-99950621 GAGCTGAGACCTCAGGGGAGGGG + Intergenic
978349277 4:107804304-107804326 GAATCTGGAGCTCAGAGGAGAGG - Intergenic
978576681 4:110196674-110196696 GAGCCGGAGCCTAAGAGGCGGGG - Intronic
979412680 4:120397779-120397801 GAGTCTGGAGCTCAGGGGAGAGG + Intergenic
980471703 4:133261730-133261752 GAACCGGGACCCAAGAGGTGAGG - Intergenic
981900442 4:149855789-149855811 GAGGCTGGAACTCAGAGGAGAGG - Intergenic
983066693 4:163218572-163218594 GAGCCTAGAGCTCAGAGGACAGG - Intergenic
983503839 4:168530939-168530961 GTGCCAAGACTTCAGAGGAGGGG - Intronic
985552411 5:540401-540423 GAGCCGGGGACACAGGGGAGGGG - Intergenic
986002685 5:3642647-3642669 GCCCTGGGAGCTCAGAGGAGGGG - Intergenic
986258500 5:6122250-6122272 GAGCTGGGGGCTCAGAGCAGAGG + Intergenic
986908350 5:12522334-12522356 AAGCCTGGACTTCAGAAGAGAGG + Intergenic
987314185 5:16709137-16709159 GACCTGGGACAACAGAGGAGGGG + Intronic
989264518 5:39457724-39457746 GAGTCTGGAGTTCAGAGGAGAGG - Intronic
989754469 5:44936049-44936071 GTGCTGGGACCTCAGCTGAGGGG + Intergenic
995232485 5:109784271-109784293 GAGCGGGACACTCAGAGGAGAGG - Intronic
997850632 5:137329651-137329673 GAGAAGGGAACACAGAGGAGCGG + Intronic
1000343218 5:160293789-160293811 GGGCTTGGACATCAGAGGAGCGG + Intronic
1000807864 5:165819565-165819587 GAGCCTGGAACTGGGAGGAGAGG - Intergenic
1001264727 5:170265527-170265549 GAGCCGAGACATCAGAAAAGTGG - Intronic
1002189143 5:177469815-177469837 GAGCCGGGGCCTAGGAGGAAGGG + Intronic
1002932847 6:1646305-1646327 GAGCACGGACCCCAGAGCAGGGG - Intronic
1003358741 6:5402799-5402821 GAGCAGGGACCACAGAAAAGTGG - Intronic
1006478553 6:34273594-34273616 GGGAAGGGGCCTCAGAGGAGAGG + Intergenic
1007825639 6:44598773-44598795 GGGAGGGGACCTCAGAGGTGGGG + Intergenic
1008496578 6:52140040-52140062 GAGCTGGAACTTCAGGGGAGGGG - Intergenic
1009973998 6:70653991-70654013 GAGTCTGGAGCTCAGAGAAGAGG - Intergenic
1011157147 6:84345547-84345569 GAGCCAGCAGCTCAGATGAGAGG - Intergenic
1011195328 6:84774351-84774373 GAGCCGGGACCGGAGAGTCGGGG - Intergenic
1015342332 6:132115500-132115522 TAGAAGGGAACTCAGAGGAGAGG - Intergenic
1016684730 6:146868287-146868309 GAGGCAGTATCTCAGAGGAGAGG + Intergenic
1019313847 7:375709-375731 GGGCCTGGCCCTGAGAGGAGAGG + Intergenic
1019639834 7:2097403-2097425 GAGCCGGGACACCTGGGGAGGGG + Intronic
1019646576 7:2132862-2132884 GAAGCAGGACCTGAGAGGAGGGG + Intronic
1020272947 7:6607776-6607798 GAGCCAGGACCCCACAGGCGAGG - Intronic
1020505294 7:8979312-8979334 GAGAATGGAGCTCAGAGGAGAGG + Intergenic
1020932328 7:14413465-14413487 GAGCCTGGATCTCAGAGGAGAGG + Intronic
1021588522 7:22236308-22236330 GGGCCTGGAACTCAGAGAAGTGG - Intronic
1023311651 7:38893392-38893414 GAGGTGGGAGCACAGAGGAGTGG - Intronic
1023745203 7:43316792-43316814 GAGACGGGACGGGAGAGGAGAGG - Intronic
1024230621 7:47360794-47360816 GTGCCGGGCCCTCAGAGCATGGG - Intronic
1024551032 7:50562452-50562474 CAGCCATGACCACAGAGGAGAGG + Intronic
1025237063 7:57241687-57241709 GAGACCAGAACTCAGAGGAGCGG + Intergenic
1026464675 7:70643932-70643954 GAGCCAGGACGTCATAGCAGAGG - Intronic
1026876486 7:73881958-73881980 GAGCAGAAACCTCAGAGGAGGGG - Intergenic
1029281633 7:99439235-99439257 GTCCCGGGATCACAGAGGAGCGG - Intronic
1029708513 7:102287413-102287435 CAGCCGGGTCCTTAGAGGAGGGG + Intronic
1029992235 7:104973158-104973180 CAGCCTGGACAACAGAGGAGAGG + Intergenic
1033585159 7:142769419-142769441 GAGAGGGGGCCTCAGAGCAGTGG + Intergenic
1034563267 7:151894919-151894941 GAGCAGGGAGGGCAGAGGAGCGG - Intergenic
1034563282 7:151894970-151894992 GAGCAGGGAGGGCAGAGGAGCGG - Intergenic
1035456371 7:159011602-159011624 GAGCCAGGACCACAGAGCAGGGG + Intergenic
1035717336 8:1764069-1764091 GGGCCGGGAACTCAGCTGAGGGG + Intronic
1036175487 8:6534023-6534045 GAGCTGGGAGCTTAGAGAAGTGG - Intronic
1036563306 8:9916390-9916412 GAGAAGGGCCCTCAGAGGAAAGG - Intergenic
1036749550 8:11435197-11435219 GAGAAGGGACCACAGGGGAGGGG - Intronic
1037920684 8:22803326-22803348 GAGCCTGGAACTCCCAGGAGAGG - Intronic
1039900989 8:41752458-41752480 GAGCCTGGAACTCAGATAAGAGG - Intronic
1040034860 8:42860177-42860199 GAGTCTGGAGCTCAGAGGAGAGG + Intronic
1040537411 8:48322429-48322451 CAGCTGGGAGCTCAGAGGTGTGG + Intergenic
1042039620 8:64578127-64578149 GAGCCGGGATGGCAGAGCAGGGG - Intergenic
1042048581 8:64682784-64682806 GAGTCTGGATTTCAGAGGAGAGG - Intronic
1042318957 8:67454943-67454965 GAGCATGGAGCACAGAGGAGGGG + Intronic
1047113959 8:121819679-121819701 GAGCCGGGACATTAGCAGAGTGG - Intergenic
1047358687 8:124147339-124147361 GAGCCCGGAACTAAGAGGAGTGG - Intergenic
1049642688 8:143722541-143722563 GGGTGGGGTCCTCAGAGGAGTGG - Intergenic
1050489444 9:6172708-6172730 GAGCTGGGACCTCACCTGAGGGG - Intergenic
1050545222 9:6703948-6703970 GAGCGGTGACCTCAGAGGCGCGG - Intergenic
1050546764 9:6716122-6716144 GAGCCGTGACGTCAGAGGCGGGG - Intergenic
1051342151 9:16121450-16121472 GAGCAGGGCCCTGAGAGAAGGGG - Intergenic
1052366678 9:27619880-27619902 GAGACAGGACCTCAGAGGCTGGG - Intergenic
1053466474 9:38312196-38312218 GAGCCGTGACCTGGGAGGCGGGG - Intergenic
1054761311 9:69006639-69006661 GAGCCAGGACCCCAGGGGAATGG - Intronic
1057014307 9:91637472-91637494 GGGCCTAGACCTCTGAGGAGAGG - Intronic
1058734828 9:107884599-107884621 CAGCTGGGTCCTCACAGGAGTGG - Intergenic
1058906909 9:109489321-109489343 GAGGTGGGACCACAGAGGTGTGG + Intronic
1059235859 9:112760269-112760291 GAGCTGGGACCTTAGAGGAAGGG + Intronic
1059344216 9:113617093-113617115 GACCAGGGAGCCCAGAGGAGAGG + Intergenic
1060282010 9:122221266-122221288 GGGCCGGGACCTCCGAGAAGCGG - Intronic
1060666701 9:125436075-125436097 GGGCCTGGGCCTCAGAGGTGGGG + Intergenic
1060816977 9:126640197-126640219 GAGCGGGGACCTCTGAGGACTGG + Intronic
1061017643 9:127991213-127991235 GAGCAGGTACCTAAGAGGACAGG - Intergenic
1061255355 9:129452007-129452029 GAACCTGGAGCCCAGAGGAGTGG + Intergenic
1061400798 9:130367284-130367306 GTGTCTGGAGCTCAGAGGAGAGG + Intronic
1061536266 9:131252210-131252232 AAACCGAGACCTGAGAGGAGGGG + Intergenic
1062158791 9:135068487-135068509 GAGCTGGGAATTCAGAGAAGAGG + Intergenic
1062180232 9:135187498-135187520 GAGCAGAGAGCTCCGAGGAGCGG + Intergenic
1062283162 9:135760857-135760879 GAGCGGGCAGCTCACAGGAGCGG - Intronic
1062434844 9:136542337-136542359 GAGCCGGGAGCGCAGTGGCGGGG + Intronic
1062478822 9:136742277-136742299 GAGCCGGGGCCTCTGAGGTAGGG - Intronic
1062627061 9:137448139-137448161 CAGCAGTGACCTCACAGGAGTGG + Exonic
1186525774 X:10247031-10247053 GAGCCAGGCCCTCAGAAGGGAGG - Intergenic
1187457013 X:19450319-19450341 TAGCCTGGACAACAGAGGAGAGG + Intronic
1192315068 X:70044721-70044743 GAGCAGGGCCCAGAGAGGAGAGG - Intronic
1193713670 X:84910060-84910082 TAGCCTGGAGCTCAGAGAAGAGG + Intergenic
1195696780 X:107673320-107673342 TAACTTGGACCTCAGAGGAGAGG - Intergenic
1197863139 X:130991416-130991438 GAGCGGGGAACCCAGAAGAGGGG - Intergenic
1198108327 X:133481650-133481672 GAGCTTGGAATTCAGAGGAGAGG + Intergenic
1199856764 X:151765400-151765422 GAGTCTGGTGCTCAGAGGAGAGG - Intergenic
1200179483 X:154141550-154141572 GAGAGGGGACTTCAGAGCAGGGG + Intergenic
1201759186 Y:17518951-17518973 GAGCTGGGACCTCAGAGCCCCGG + Intergenic
1201842369 Y:18387039-18387061 GAGCTGGGACCTCAGAGCCCCGG - Intergenic