ID: 1160241362

View in Genome Browser
Species Human (GRCh38)
Location 18:77125534-77125556
Sequence CATGACCACATGTTCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160241359_1160241362 11 Left 1160241359 18:77125500-77125522 CCTGGCTTCTATATGTCATATAA 0: 1
1: 0
2: 1
3: 9
4: 193
Right 1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG 0: 1
1: 0
2: 4
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160241362 Original CRISPR CATGACCACATGTTCTTTTG TGG Intronic
901165195 1:7215710-7215732 CATGATCACATGTACATTTTTGG + Intronic
902535285 1:17116207-17116229 CAGGACCACAAGGTCTATTGAGG + Intronic
906582156 1:46944992-46945014 CATGACCTCATCCTCTTTTATGG - Intergenic
906812540 1:48843466-48843488 CATGACCACCTGTTTTTGTATGG + Intronic
909181789 1:72433564-72433586 CATGACCACAGGTCCCTCTGGGG - Intergenic
911778326 1:101843234-101843256 CATGCCCACAGGTTCCTTCGAGG + Intronic
913025834 1:114838898-114838920 CATGACCACCTATTCTTTAAAGG + Intergenic
915043679 1:152992050-152992072 CATGACCACCTGATCCTTTTAGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918397239 1:184126411-184126433 CCTGAACACATGTTTTTTTAAGG + Intergenic
918945347 1:191057610-191057632 CATGAACTCATGCTTTTTTGTGG + Intergenic
919045987 1:192452653-192452675 CATGACCTTATGCTTTTTTGAGG - Intergenic
922652656 1:227354581-227354603 CATGACCACAGGTCCATTTAGGG + Intergenic
924355335 1:243168156-243168178 TATGACCAAAAATTCTTTTGAGG - Intronic
1063751738 10:8956907-8956929 CATGACCACATGATATTTCTGGG + Intergenic
1064499339 10:15951993-15952015 TATGACCTCAAATTCTTTTGGGG + Intergenic
1067261902 10:44700126-44700148 CATGAACACATGTTTCCTTGGGG - Intergenic
1068064184 10:52108356-52108378 CATGTCTACATGTTTTTTTCAGG + Intronic
1068551360 10:58411418-58411440 CATGACCTCATTCTTTTTTGTGG + Intergenic
1069848206 10:71387656-71387678 AATGACAGCAAGTTCTTTTGTGG + Intergenic
1073505776 10:103988001-103988023 TATGACTTCATTTTCTTTTGAGG - Intronic
1073556429 10:104456593-104456615 CATAACAACAGGTTGTTTTGAGG + Intergenic
1073668068 10:105555889-105555911 CATGAACACATGATTTTTTATGG - Intergenic
1074615154 10:115060255-115060277 CATGACCATGAGGTCTTTTGGGG + Intergenic
1075215760 10:120532234-120532256 CATGAACTCATCTTTTTTTGTGG + Intronic
1075263638 10:120982866-120982888 AAGGACCACATGTTCTATTCTGG + Intergenic
1075858780 10:125655685-125655707 GATGGCCACATTTACTTTTGGGG - Exonic
1077590562 11:3487785-3487807 CATGGCCACATGTTCTCTGGGGG - Intergenic
1078984318 11:16576445-16576467 TATGACAACATGTGTTTTTGAGG - Intronic
1080142816 11:28942954-28942976 CATGACCACATGCTCTCTTAAGG + Intergenic
1080228216 11:29985006-29985028 CACGACCAGAAGTTATTTTGGGG + Intergenic
1081193442 11:40132552-40132574 CATTACTACATTTTCCTTTGAGG - Intronic
1084246283 11:67859566-67859588 CATGGCCACATGTTCTCTGGGGG - Intergenic
1084826399 11:71734934-71734956 CATGGTCACATGTTCTCTGGGGG + Intergenic
1086205227 11:84250034-84250056 CAGGACCGCCAGTTCTTTTGAGG + Intronic
1086777710 11:90860177-90860199 CATGAACACATCTTTTTTTATGG - Intergenic
1087470702 11:98570586-98570608 CTTGACCACCTGTTCTTGGGAGG - Intergenic
1087788926 11:102386491-102386513 CATTACCTCATTTTCTTTTGTGG + Intergenic
1088340463 11:108759891-108759913 TATGGCCACATGTTTTTGTGTGG + Intronic
1088563107 11:111135576-111135598 GGTGACCACCTGCTCTTTTGTGG - Intergenic
1089866366 11:121636178-121636200 CATCATCACATGTTCTATTAGGG + Intergenic
1092047724 12:5444080-5444102 CATGTTTACATCTTCTTTTGGGG + Intronic
1092416849 12:8296690-8296712 CATGGCCACATGTTCTCTGGGGG - Intergenic
1092492021 12:8954059-8954081 CATGTCCATATGATTTTTTGAGG + Intronic
1092799153 12:12146311-12146333 CATGCCCTCATGTGCTTTGGTGG - Intronic
1093300750 12:17451834-17451856 AATGTCCTCATGTACTTTTGAGG + Intergenic
1093568866 12:20642647-20642669 CATGATCACAGGTACTTCTGAGG - Intronic
1094490276 12:30956654-30956676 CTGGACCACATTTTCTTTTACGG - Intronic
1094624711 12:32112720-32112742 CATGGCCACATTTTGTCTTGGGG + Intronic
1094756344 12:33473579-33473601 CATGAGCACAAGTTTTTTTCTGG - Intergenic
1098177272 12:67805860-67805882 CATCACCAAATGTTCATTTTAGG + Intergenic
1098187846 12:67916780-67916802 CAGGAGCACATGTTCCTTTATGG + Intergenic
1099946006 12:89245182-89245204 GATTACCACATATTCTTTAGAGG + Intergenic
1101625289 12:106434807-106434829 CACTACCTCATTTTCTTTTGAGG + Intronic
1103674757 12:122646917-122646939 AATTACCACTTCTTCTTTTGAGG - Intergenic
1103919291 12:124391037-124391059 CATGACGAGCTGTTCTTGTGGGG + Intronic
1106357165 13:28994224-28994246 CATGAACTCATGTTTTTTTATGG + Intronic
1106441574 13:29778143-29778165 CATGACCATATATTTTTTAGGGG + Intronic
1109045301 13:57403424-57403446 CATTTCAACATGTTCTTATGAGG + Intergenic
1109517090 13:63457899-63457921 CATGACCCAAAGTTATTTTGTGG - Intergenic
1109798971 13:67349657-67349679 CATGAACACATCCTTTTTTGTGG + Intergenic
1110009297 13:70311698-70311720 CATAACCAAATATTATTTTGAGG + Intergenic
1110504637 13:76271378-76271400 CATGAACTCATGCTTTTTTGTGG + Intergenic
1112608993 13:100937510-100937532 CATGACCTCATTCTTTTTTGTGG + Intergenic
1114402688 14:22424293-22424315 TATCACCACAAGTTCTTATGAGG - Intergenic
1114759135 14:25292286-25292308 CATGATCTCATCTTTTTTTGTGG - Intergenic
1115129584 14:30038562-30038584 CATGACCACATGCGCATTTCAGG + Intronic
1115169790 14:30491798-30491820 CTTGAACTCATGTTCTTTTGAGG - Intergenic
1116975525 14:51111517-51111539 CATGACCTCATTCTTTTTTGTGG - Intergenic
1118039870 14:61904958-61904980 CATGAACACATTTTCTTATGTGG + Intergenic
1119554051 14:75540033-75540055 CATGATTACATGTCCTGTTGAGG + Intronic
1119997387 14:79268511-79268533 CATTACCACATGTTTTCTTCTGG - Intronic
1120235384 14:81884601-81884623 CAGGAACACATCTTCTTTGGTGG + Intergenic
1121563567 14:94892490-94892512 CATGTCCACATCTTCTCTGGAGG + Intergenic
1124377123 15:29135397-29135419 CATAACCCCATGTTCCTTGGAGG + Intronic
1133355931 16:5136870-5136892 CATGGCCACATGTTCTCTGGGGG - Intergenic
1133605824 16:7386548-7386570 CATGATCTCATGTTTTTTTATGG + Intronic
1134028056 16:10969714-10969736 CATGCCCAGATGTTGTCTTGGGG + Intronic
1134818580 16:17227179-17227201 CATGACCAGGTGTTCATTTTAGG - Intronic
1138350523 16:56344111-56344133 CGTTACCACAAGTTCTGTTGGGG - Exonic
1140309582 16:73835955-73835977 CATGAGCCCATTTTCTTTTGTGG - Intergenic
1140776995 16:78258366-78258388 AATGCCAACATGTTCTTTTTTGG + Intronic
1142571298 17:876443-876465 CATGACCACATCCCCTATTGTGG + Intronic
1146556614 17:33830435-33830457 CATGACCACAAGTTGTTTTCAGG - Intronic
1147685991 17:42287335-42287357 CAAGACTGCATGTTCTGTTGGGG - Intergenic
1148383363 17:47216994-47217016 CATCATTACATCTTCTTTTGAGG + Intronic
1148644837 17:49213755-49213777 CAATTCCACATGTTCGTTTGGGG + Intronic
1149088975 17:52754495-52754517 CATGACAACATGGACTTTTCTGG + Intergenic
1150961672 17:69920019-69920041 AATGAGAACATGTTCTTTTTGGG + Intergenic
1153246064 18:3073724-3073746 CATGCCCACATGTGCATTGGGGG + Intronic
1154933801 18:21029914-21029936 AATAACCTCATGTTCTTTTAGGG + Intronic
1155115709 18:22764611-22764633 CATGAACTCATCTTTTTTTGTGG - Intergenic
1156318018 18:35989205-35989227 CAAGATCACATATTCTTTTGTGG - Intronic
1157501899 18:48196584-48196606 CGTGGCCACATCTTCTTATGGGG - Intronic
1157722173 18:49933565-49933587 CATTGCCAAATGTTCTCTTGGGG - Intronic
1158062647 18:53364826-53364848 CATGTGCACATGTACATTTGTGG - Intronic
1159957421 18:74529825-74529847 CATGACCATCTGTTGTTCTGAGG - Intergenic
1160241362 18:77125534-77125556 CATGACCACATGTTCTTTTGTGG + Intronic
1162897181 19:13771970-13771992 CATGCCTGCATGTACTTTTGGGG + Intronic
926865422 2:17351972-17351994 CATGGCCATATGTTTCTTTGTGG - Intergenic
929384608 2:41390800-41390822 CAAGAACACATCTGCTTTTGTGG + Intergenic
930246814 2:48991900-48991922 AAGGACCATATGTCCTTTTGAGG + Intronic
938304266 2:130240456-130240478 CATGACCACATTTGATTTTTTGG - Intergenic
938749021 2:134310983-134311005 CATGGCCACATGTTCATATCAGG + Intronic
940105510 2:150094802-150094824 CATAACAACATGTACTTTTAAGG - Intergenic
942316850 2:174705007-174705029 CAAGACCAAATTTTATTTTGGGG + Intergenic
943601427 2:189925572-189925594 CATGTCCATAGGTTCATTTGTGG + Intronic
944491679 2:200263852-200263874 CATGGCAACATCTGCTTTTGTGG - Intergenic
946336979 2:219044333-219044355 CATGAACTCATCTTTTTTTGTGG - Intergenic
946390715 2:219415360-219415382 CACAACCACATTTTCTTATGTGG - Intergenic
947389239 2:229622580-229622602 CATCAACAAATCTTCTTTTGGGG - Intronic
948041911 2:234908854-234908876 CATGATCACCTTTTGTTTTGAGG + Intergenic
948118411 2:235511034-235511056 CATGGCCAAATGTCCTCTTGGGG - Intronic
948963666 2:241359367-241359389 CATGACCACATTTTCATTTTGGG - Intronic
1169379837 20:5096778-5096800 CAGGACACCATGTTCCTTTGAGG - Intronic
1170039723 20:12027210-12027232 CATGACCACATCTTCATTGAAGG + Intergenic
1170095515 20:12641836-12641858 CATGGCCACATGTACTTCTGAGG + Intergenic
1170978183 20:21186255-21186277 CATGACCAGAAATTCTTTTAGGG - Intronic
1171017167 20:21552557-21552579 CATGACCATTTGTTCCTGTGGGG - Intergenic
1171259075 20:23715425-23715447 CATGAACTCATCTTTTTTTGTGG + Intergenic
1171276691 20:23862095-23862117 CATGAACACATTCTCTTTTATGG + Intergenic
1171374730 20:24684879-24684901 CATGACCACAATTGCTCTTGAGG - Intergenic
1173452421 20:43176712-43176734 CAAATCCACATGTTCTTCTGTGG - Intronic
1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG + Intronic
1178077221 21:29023414-29023436 TATGACCAATTGTTCTTTTATGG + Intergenic
1178480738 21:32977563-32977585 CTTGACAACATGTTCTTGTTTGG + Intergenic
1180379175 22:12122844-12122866 CATGACCACATATTTTTTTTTGG + Intergenic
949578752 3:5365082-5365104 CATGATCACAAGTTGGTTTGAGG - Intergenic
951385506 3:22037023-22037045 GATGACTTCATGTTCTTTTTGGG - Intronic
951717683 3:25665508-25665530 ACTGACCATATGCTCTTTTGGGG - Intergenic
954422104 3:50424251-50424273 CTTGGCCACAGGTTCTTTTTTGG + Intronic
955659451 3:61281106-61281128 CATGATAGCTTGTTCTTTTGTGG - Intergenic
956191292 3:66610783-66610805 CATGACCAAATGTTCCTTGGGGG + Intergenic
957190654 3:77004905-77004927 CATGACCACATTTTCTTCCTTGG - Intronic
957345108 3:78950329-78950351 CATGAACTCATGATCTTTTATGG - Intronic
957933586 3:86913755-86913777 CAAGACCATAGGTACTTTTGAGG - Intergenic
959256695 3:104024341-104024363 CATGACCTCATTTCCTTTTATGG - Intergenic
961894402 3:130155291-130155313 CATGGCCACATGTTCTCTTGGGG - Intergenic
963162279 3:142163062-142163084 CATGACCACATTTGCTTTTGTGG - Intergenic
964396320 3:156249762-156249784 CATGGCCACATGTGCTAGTGGGG + Intronic
965759803 3:172063665-172063687 AATGATCACATGATGTTTTGAGG + Intronic
969004491 4:4008370-4008392 CATGGCCACATGTTCTCTGGGGG - Intergenic
969748377 4:9091778-9091800 CATGGCCACATGTTCTCTGGGGG + Intergenic
969809408 4:9636337-9636359 CATGGCCACATGTTCTCTGGGGG + Intergenic
970630962 4:17943990-17944012 CATGCCCATATCCTCTTTTGAGG - Intronic
971056517 4:22919404-22919426 CATGATCTCAGGTTCTTTTAAGG + Intergenic
972703686 4:41518906-41518928 CATGAACACATTTTTTTTTACGG + Intronic
972905817 4:43745789-43745811 CATGAACTCATGCTTTTTTGTGG - Intergenic
973182109 4:47282222-47282244 CTAAAACACATGTTCTTTTGTGG + Intronic
974277400 4:59741232-59741254 CCTGACCTAAAGTTCTTTTGTGG - Intergenic
974281560 4:59801739-59801761 CATGATCTCATTTTTTTTTGTGG - Intergenic
975528706 4:75378407-75378429 CATGACCCCTTGTGCTTCTGGGG - Intergenic
976111497 4:81679133-81679155 CTTAACCAAATGATCTTTTGAGG + Intronic
976814385 4:89130294-89130316 CATAACCTTATCTTCTTTTGTGG + Intergenic
977403503 4:96564823-96564845 CATGATCTCATTCTCTTTTGTGG + Intergenic
977606107 4:98986524-98986546 AATGACCACATCTTATTCTGAGG - Intergenic
979019437 4:115477542-115477564 CATGATCTCATTTTCTTTTATGG - Intergenic
980218168 4:129878238-129878260 CATGAGCTCATCTTCTTTTATGG + Intergenic
980581716 4:134762838-134762860 CATGACTACATTTACTTGTGAGG - Intergenic
981082770 4:140651539-140651561 TAGGTCCACATTTTCTTTTGAGG + Intronic
981741702 4:148009066-148009088 CATGATCAGAAGTTCTTTGGGGG + Intronic
982695919 4:158600549-158600571 TAGGACCTCAGGTTCTTTTGGGG - Intronic
984087681 4:175332560-175332582 AATGACCACAGGTTCTTTTGGGG - Intergenic
984423056 4:179549761-179549783 CATGAACTCATCCTCTTTTGTGG - Intergenic
986991615 5:13559666-13559688 CAGGACCACTTTCTCTTTTGTGG - Intergenic
987674117 5:21051986-21052008 CAAGAGCACATGTCCGTTTGGGG - Intergenic
988421661 5:31013375-31013397 CAAGTACACATGTTCCTTTGAGG + Intergenic
990651411 5:57904164-57904186 CATTACCACCTTCTCTTTTGGGG + Intergenic
991018558 5:61957409-61957431 CATGACCTCATCATTTTTTGTGG - Intergenic
992244013 5:74799183-74799205 CATGACCACATCGTCACTTGTGG + Intronic
993445474 5:88006732-88006754 CATCATCACATGTTCCTTCGAGG - Intergenic
994426553 5:99595537-99595559 CAAGATCATCTGTTCTTTTGAGG + Intergenic
995127272 5:108590725-108590747 CAACACCACAAGTCCTTTTGTGG - Intergenic
995132890 5:108648692-108648714 CATGGCAACATTTGCTTTTGAGG - Intergenic
995224326 5:109687199-109687221 AATGGCCACATGTCGTTTTGGGG + Intergenic
996912241 5:128669057-128669079 CATGACCACATGGTCATCTCAGG - Intronic
997044707 5:130300316-130300338 GATGATCACAAGTTCTTTTGAGG - Intergenic
997390382 5:133510334-133510356 ACTTACCACATGGTCTTTTGGGG - Intronic
999054087 5:148554973-148554995 CATGACCTCATTCTCTTTTGGGG + Intronic
999546691 5:152637109-152637131 CATGACCACATATGCTTTAGGGG - Intergenic
1002479969 5:179493567-179493589 CATGTCCACAAATACTTTTGAGG - Intergenic
1004265082 6:14142237-14142259 CATCACCACATGTTAGATTGCGG + Intergenic
1004798012 6:19111111-19111133 CATGATCACATTTCTTTTTGTGG - Intergenic
1006556528 6:34871873-34871895 CAAAAACACCTGTTCTTTTGGGG - Exonic
1007741828 6:44015452-44015474 ATTGACCATATGTTGTTTTGTGG - Intergenic
1008121262 6:47619854-47619876 CATTTGCACATCTTCTTTTGAGG + Intronic
1008946388 6:57101516-57101538 CATGACCTCCATTTCTTTTGAGG - Intronic
1009500221 6:64403713-64403735 CATGACCCAATATTCTTTTCAGG - Intronic
1009574671 6:65437564-65437586 CATGTCCATATGTTATTATGTGG - Intronic
1011275088 6:85622892-85622914 AAAGAGCACATGTTCTTTTCTGG - Intronic
1011903631 6:92333512-92333534 CATTACCACACATTTTTTTGTGG + Intergenic
1013225840 6:108118870-108118892 CACGACCTCATATTCTTGTGCGG + Intronic
1013643026 6:112106780-112106802 TTTGACAACATGTTCTGTTGAGG + Intergenic
1014029645 6:116685610-116685632 CATGATCACATTCTTTTTTGTGG + Intronic
1015178996 6:130341750-130341772 CATGGAAACATGATCTTTTGAGG + Intronic
1015208470 6:130668895-130668917 CATGACAACATATTGTTCTGAGG - Intergenic
1016549031 6:145256077-145256099 CATGACCAAAAATTTTTTTGTGG - Intergenic
1017557740 6:155590329-155590351 CTTTAGCACATGTGCTTTTGGGG + Intergenic
1019602175 7:1890181-1890203 CAGGACCACGTGTTCTGGTGTGG + Intronic
1020324627 7:6964869-6964891 CATGGCCACATGTTCTCTGGGGG - Intergenic
1022108182 7:27211671-27211693 CATGGCCACATATTCCTTTGGGG + Intergenic
1023226741 7:37977854-37977876 CATGACCACATTTGATTTTTTGG + Intronic
1024153456 7:46596613-46596635 CATGAACTCATCCTCTTTTGTGG - Intergenic
1024688078 7:51769954-51769976 CATGGCCACATGTTCTGTGCCGG + Intergenic
1024986287 7:55195844-55195866 CATGATCTCATTCTCTTTTGTGG + Intronic
1025716321 7:63960172-63960194 CATGAACTCATCTTTTTTTGTGG + Intergenic
1026401531 7:70019079-70019101 CATGACCTCATTCTTTTTTGTGG - Intronic
1028332961 7:89619965-89619987 CATGTCTGCATGTTCTTTGGGGG + Intergenic
1029657012 7:101933117-101933139 CATGAACACATGTAGTGTTGAGG + Intronic
1029789882 7:102831290-102831312 CCTTACCACATGTTCTCTGGTGG - Intronic
1029996232 7:105011337-105011359 CTTGACCTCAGGTTCTTTTCAGG + Intergenic
1031085733 7:117299919-117299941 CACCACCACATGTTTTTTTAAGG - Intronic
1031941058 7:127789861-127789883 CATGGCCACTATTTCTTTTGAGG - Intronic
1032245715 7:130209951-130209973 CTGGACCACATGCTCTCTTGAGG - Intronic
1032856190 7:135835441-135835463 CATGGCAACATCTGCTTTTGGGG + Intergenic
1033275016 7:139965228-139965250 AAGGACCACATGTTATTATGGGG + Intronic
1036371439 8:8166072-8166094 CATGGCCACGTGTTCTCTGGGGG + Intergenic
1036879464 8:12499572-12499594 CATGGCCACGTGTTCTCTGGGGG - Intergenic
1038617250 8:29106033-29106055 CATGACTTCCTGTGCTTTTGTGG - Intronic
1039321492 8:36436707-36436729 CAAGACCACATCTTCCTTTGGGG + Intergenic
1040275384 8:46011178-46011200 CAGGAAGACATTTTCTTTTGTGG + Intergenic
1042167427 8:65959164-65959186 CATGGCCACAAATCCTTTTGAGG - Intergenic
1042352104 8:67787767-67787789 CATGGCGACATCTGCTTTTGGGG + Intergenic
1043159094 8:76823193-76823215 CATGATCATATTTTCTTCTGTGG - Intronic
1043890794 8:85650725-85650747 CATGAACACATGCTTTTTTATGG + Intergenic
1043893694 8:85719778-85719800 CATGAACACATGCTTTTTTATGG - Intergenic
1043896374 8:85741227-85741249 CATGAACACATGCTTTTTTATGG - Intergenic
1043898627 8:85758948-85758970 CATGAACACATGCTTTTTTATGG + Intergenic
1043900240 8:85771142-85771164 CATGAACACATGCTTTTTTATGG + Intergenic
1043902202 8:85786417-85786439 CATGAACACATGCTTTTTTATGG + Intergenic
1043903811 8:85798610-85798632 CATGAACACATGCTTTTTTATGG + Intergenic
1043905423 8:85810804-85810826 CATGAACACATGCTTTTTTATGG + Intergenic
1043907032 8:85822991-85823013 CATGAACACATGCTTTTTTATGG + Intergenic
1043979553 8:86622344-86622366 CATCTACACATTTTCTTTTGGGG + Intronic
1044420385 8:91989050-91989072 CATAATCACATTTTCATTTGTGG + Intronic
1045748185 8:105449314-105449336 CATTAACACATGTTATTGTGGGG - Intronic
1046228118 8:111313529-111313551 CATGAACACATGTACTATTCTGG + Intergenic
1046240055 8:111478301-111478323 CAGGACCATTTGTTCCTTTGGGG + Intergenic
1046343179 8:112885544-112885566 CCTGACTTCATGTTCTTTTGTGG + Intronic
1046804730 8:118467530-118467552 CATGGCCACATGTTCTGCAGGGG - Intronic
1047759485 8:127943645-127943667 CATTGCCACATGTTCTTTTGTGG + Intergenic
1048158820 8:131992196-131992218 CATGACCACATACTGCTTTGTGG + Intronic
1051006283 9:12348945-12348967 CATGAACTCATCTTCTTTTATGG + Intergenic
1052131192 9:24849089-24849111 CATGACCATATTTTCTTTCAGGG + Intergenic
1052395707 9:27935518-27935540 CAGGATCACATGTCTTTTTGTGG + Intergenic
1053064686 9:35059640-35059662 GATGAACACATTTTTTTTTGTGG + Exonic
1054414540 9:64859974-64859996 CATGAGTACATGTTCTTTGCAGG - Intergenic
1054844065 9:69773864-69773886 CATGAACACATTTTTTTTTATGG - Intergenic
1058012552 9:99994320-99994342 CATGAACTCATCTTTTTTTGTGG - Intronic
1058755127 9:108076720-108076742 CCTGACCAAATGTTCTTTTTTGG + Intergenic
1059633063 9:116145510-116145532 CATGACCTCATTTTTTTTTATGG - Intergenic
1059652922 9:116332613-116332635 CATAACCACATCTTGATTTGAGG - Intronic
1059917859 9:119123782-119123804 CATTGCCATATGTTCTCTTGGGG + Intergenic
1203541563 Un_KI270743v1:93210-93232 CATGACCACATATTTTTTTTTGG + Intergenic
1186086804 X:5999694-5999716 CATGTGCATTTGTTCTTTTGGGG - Intronic
1187326548 X:18295500-18295522 CATGAACACATGCTGCTTTGGGG + Intronic
1188202225 X:27305340-27305362 AATGAGCTCATGTTCTTTTCAGG + Intergenic
1190064708 X:47231933-47231955 CATTACCAAATGTCCTTTGGGGG - Intergenic
1191163528 X:57362170-57362192 CATGAACTCATCTTTTTTTGTGG - Intronic
1194259165 X:91672565-91672587 CATGAGCTCATCTTTTTTTGTGG - Intergenic
1195579247 X:106482835-106482857 CATTACCACTTGTTCTTTACTGG + Intergenic
1196588712 X:117460562-117460584 CACGGCCACATGTTCTCTTCTGG - Intergenic
1196899273 X:120367292-120367314 CATGACCAAGTGTTTTTATGAGG + Intronic
1197254758 X:124250937-124250959 AATGACCACATCTTCAGTTGGGG - Intronic
1200577863 Y:4911764-4911786 CATGAACTCATCTTTTTTTGTGG - Intergenic
1201260493 Y:12154370-12154392 CATGTCCACATGCCCTTTGGAGG + Intergenic