ID: 1160242273

View in Genome Browser
Species Human (GRCh38)
Location 18:77132507-77132529
Sequence GCCCCTCCGAGTGGGGACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160242273_1160242285 30 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG 0: 1
1: 0
2: 2
3: 11
4: 65
1160242273_1160242278 -7 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242278 18:77132523-77132545 GAGGGGCACAGAGACAAAGGCGG 0: 1
1: 0
2: 7
3: 68
4: 636
1160242273_1160242280 19 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242280 18:77132549-77132571 AGCAGCCCGCCCGTCCCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 174
1160242273_1160242277 -10 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242277 18:77132520-77132542 TCGGAGGGGCACAGAGACAAAGG 0: 1
1: 0
2: 1
3: 19
4: 218
1160242273_1160242279 18 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242279 18:77132548-77132570 GAGCAGCCCGCCCGTCCCCGAGG 0: 1
1: 0
2: 2
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160242273 Original CRISPR GCCCCTCCGAGTGGGGACCG CGG (reversed) Intronic
900165540 1:1243005-1243027 GCCCCTCCAAGGGTGGTCCGGGG + Intronic
900366752 1:2314761-2314783 GCCCCTCCGCGTGGGGAAGTGGG - Intergenic
900651164 1:3730718-3730740 GCCCCGCCTAGTAGGGACGGGGG - Intronic
901512481 1:9724448-9724470 GCCCCTCGGTGTGGGGCCCCAGG + Intronic
902214339 1:14924755-14924777 GTTCCTCGGCGTGGGGACCGGGG + Intronic
902293118 1:15447769-15447791 TCCCCTGGGAGTGGGGACCATGG + Intronic
902716389 1:18275792-18275814 GCTCCTCCCAGTGGGGCCCCTGG + Intronic
903447396 1:23431169-23431191 GCCCCTCAGAGTGGGGAGAAAGG + Intronic
908349971 1:63276920-63276942 TCCCCTCCTAGTGGGGAGCATGG - Intergenic
911960857 1:104301053-104301075 GCCCTTCCCAGTGGTCACCGTGG + Intergenic
915366695 1:155320923-155320945 GCCCCGCCGGGCGGGGACCGTGG + Exonic
915557695 1:156669555-156669577 TCCCCTCCAAGTTGGGACCCTGG + Exonic
916120557 1:161524934-161524956 GCCCTTCCGGGTGGTGAGCGAGG + Exonic
920110105 1:203581782-203581804 GCCCCTGCAGGTGGGGACCCTGG - Intergenic
922892901 1:229075227-229075249 GCCCCTCAGAGTGAGGACAAGGG - Intergenic
1063098351 10:2927997-2928019 GCCCCACTGAGTGGGGTCCCTGG + Intergenic
1065215002 10:23439921-23439943 GCCCCGCCGCGGCGGGACCGGGG - Exonic
1066656367 10:37702292-37702314 GCGCCTCCCAGTGGGAACCCCGG + Intergenic
1067055724 10:43048780-43048802 GCCCTTCTGAGTGGGGCCCTGGG + Intergenic
1070152009 10:73811136-73811158 GCCCCGCCGAGAGGAGACGGGGG + Intronic
1073009891 10:100350871-100350893 TTCCCTCAGAGTGGGGACTGAGG - Intronic
1076648636 10:131971825-131971847 GCCCCTCGGAGTGGGGCCAGGGG + Intronic
1076993791 11:288982-289004 GCCGCTGCCAGCGGGGACCGAGG + Intergenic
1076993847 11:289107-289129 GGCCCTCGGGGCGGGGACCGCGG + Intergenic
1078454154 11:11462179-11462201 GATTCTCAGAGTGGGGACCGTGG - Intronic
1080456895 11:32427001-32427023 TCCCCTCCGCGCGGGGACCCGGG - Intronic
1083326341 11:61874828-61874850 GCCCCTCAGGGTGGGGACAGGGG - Intronic
1083868500 11:65471893-65471915 GCCCCTCAGGGTGGGGGCCATGG - Intergenic
1083959624 11:66007355-66007377 GCCCCTCCCTGTGGGGACCAGGG + Intergenic
1084170210 11:67397314-67397336 CCTCCTCGGAGTGGGGACCGGGG - Exonic
1084665553 11:70574337-70574359 GCCTCTCCCAGTGGGGAAGGTGG - Intronic
1089019602 11:115199283-115199305 GCCCCTCAGAATGGTGAACGTGG - Intronic
1091815947 12:3438077-3438099 CCACCTCCGAGTGGGGAGCCTGG + Intronic
1093443791 12:19230642-19230664 GCCACTCTGAGTGCGGCCCGCGG + Intronic
1094837685 12:34329791-34329813 GTCCATCCTAGTGGGGACCCAGG + Intergenic
1096094480 12:48925299-48925321 GACCCTCCAAGTGGAGACCCTGG - Exonic
1096720440 12:53517215-53517237 GGCCATCTGAGTGAGGACCGAGG + Exonic
1096983645 12:55743178-55743200 GCCCGGCCGAGGGGGGACCCGGG - Intergenic
1103275989 12:119712387-119712409 GTCCCTCCCAGTGGGAACGGGGG - Intronic
1103701650 12:122851148-122851170 GCCCCCTCCAGTGGGGACGGGGG - Intronic
1104018384 12:124975462-124975484 GCCCCGCCGAGTGGCCGCCGTGG - Exonic
1104676700 12:130716053-130716075 GCCCTTCAGCGTGGGGTCCGGGG - Intronic
1109152138 13:58859140-58859162 GCCGCTCAGAGTGTGGGCCGCGG + Intergenic
1113671614 13:112179366-112179388 GCCCCGCAGAGTGGGCACAGGGG + Intergenic
1115769344 14:36654536-36654558 GCGCCTCCGAGGCGGGCCCGAGG - Intergenic
1120786405 14:88541625-88541647 GCCCCTCTCAGGGGGGACAGAGG - Intronic
1122540097 14:102493325-102493347 GGCCTTCCGAGTGGGGAAGGCGG + Intronic
1125508668 15:40281632-40281654 CGCCCTCCGGGTGGGGACTGAGG + Exonic
1125536264 15:40442245-40442267 GCCCCTCGGAGTGGGTGCCTCGG - Intronic
1127044435 15:55011105-55011127 GCCCCTCAGGGTGGGGAAAGAGG - Intergenic
1127790128 15:62391592-62391614 GCCTCTCCGACTGGGGCGCGGGG - Intronic
1129737108 15:77972651-77972673 GGCCCTGTGTGTGGGGACCGTGG + Intergenic
1129848972 15:78780984-78781006 GGCCCTGTGTGTGGGGACCGTGG - Intronic
1132663650 16:1072340-1072362 GCCCCAGCGAGGGGGGTCCGTGG - Intergenic
1135413707 16:22253388-22253410 GCCCCCCAGGGTGGGGACTGTGG - Intronic
1137575506 16:49597235-49597257 GCACCTCCCAGTGGGAACCTGGG + Intronic
1138474978 16:57265218-57265240 GCCCTTACGAGTGTGGACCCAGG + Intronic
1141670407 16:85488797-85488819 GCCTCTTCGTCTGGGGACCGGGG + Intergenic
1142599856 17:1048309-1048331 GCCCCTCCACGTGGGGCCCCTGG + Intronic
1147176750 17:38660582-38660604 GCCCCAGAGAGTGGGGACCTGGG - Intergenic
1151780225 17:76240504-76240526 GCCGCTCCGCGCGGGGACCGCGG + Intergenic
1152657527 17:81526997-81527019 GCCCCTGAGCGTGGGGACAGTGG + Intergenic
1153684245 18:7529261-7529283 GGCCCTCCGAGAGGGAACCCAGG + Intergenic
1155425939 18:25707600-25707622 ACCCCTACGAATGGGGACCCTGG + Intergenic
1157182114 18:45507142-45507164 GCCTCTCACAGTGGGGACCCGGG - Intronic
1160242273 18:77132507-77132529 GCCCCTCCGAGTGGGGACCGCGG - Intronic
1160692881 19:467875-467897 ACCCCTCCGAGATGGGACTGGGG - Intronic
1160762511 19:792581-792603 GCCCCTCCAAGCTGGGACAGTGG - Intergenic
1160767606 19:815354-815376 CCCCCTCCCTGTGGGCACCGAGG - Intronic
1161004725 19:1929495-1929517 GCCCGTCCGACTGGAGTCCGAGG - Intergenic
1161046328 19:2136747-2136769 GCCCCTCCAGGTGGTGAGCGAGG + Intronic
1161850897 19:6737517-6737539 GCCCCGCGGAGTGGGGGCAGCGG - Exonic
1161976608 19:7611141-7611163 GATCCTCGGAGTGGGGACTGGGG - Exonic
1162469425 19:10863511-10863533 GCCCCTCAGAATGGTGACAGAGG + Intronic
1162486029 19:10961112-10961134 GCCCCTCCGCGCGGGGCCGGGGG - Exonic
1163034970 19:14564889-14564911 GACCCGCTGGGTGGGGACCGTGG - Intronic
929146386 2:38710256-38710278 GCTCCTCCAAGTGTGGACCTAGG - Intronic
932625248 2:73292034-73292056 ACCCCTCCTAGTGGGGAGGGAGG - Exonic
934588272 2:95525406-95525428 GCGCCTAGGAGTGGGGACGGCGG - Intergenic
941476151 2:165953808-165953830 GCCCCTCCCGCTGGGGCCCGGGG - Exonic
947718310 2:232352668-232352690 GCGGCTCCGAGTGGGGACCTGGG - Intergenic
947853544 2:233307691-233307713 GACCCTCCGTATGGAGACCGGGG + Intergenic
1171205232 20:23273915-23273937 GCCGCTCAGAGTGGGGTCCCTGG - Intergenic
1175844565 20:62051685-62051707 GCCCCTCAGAGGAGGGACTGTGG - Intronic
1175877843 20:62238755-62238777 GCGCCTCCCAGTGGGGGTCGAGG - Intronic
1176171091 20:63696663-63696685 GCCCCTCCGCAGGCGGACCGGGG + Exonic
1180101873 21:45591164-45591186 GCCCGGCCGCGTGGGGACCCCGG + Intergenic
1180161452 21:46000270-46000292 GCCCCTCCCAGCGGGGACTGTGG - Intronic
1181024560 22:20120638-20120660 GCCCCTCCCGCTGGGGACCAGGG - Intronic
1181367674 22:22391162-22391184 GCCCCTCTGTGTAGGGACCAAGG - Intergenic
1182439877 22:30356973-30356995 GCCCCTCCCCGCGGGCACCGCGG + Exonic
1183186607 22:36295090-36295112 TCCCCTCAGAGTGGAGGCCGGGG + Intronic
1184766231 22:46573925-46573947 GCTGCTCCGAGTGGGCACGGCGG - Intergenic
950158436 3:10741377-10741399 GCCGCTAAGAGTGGGGACCTGGG - Intergenic
950581197 3:13863210-13863232 GCCCCTCAGAGTAGGGAACTTGG - Intronic
954869882 3:53759669-53759691 GCCCCTCCAAGTGTGGTCTGTGG + Intronic
962808733 3:138945015-138945037 GCCCCGCCTAGTGGGCCCCGCGG + Exonic
969299871 4:6291509-6291531 GCCCTTCCTTGTGGGGACCAGGG + Intronic
969524336 4:7696575-7696597 GCCCCTCCGAGTAGGCATCAAGG + Intronic
985144768 4:186885293-186885315 GCCACTCTGAGTGGAGACCAGGG - Intergenic
985575104 5:670267-670289 GCCCCTCAGAGAGGGCACCATGG - Intronic
986709837 5:10480646-10480668 GCTCCTCCGAGTGTGGTCCAAGG + Intergenic
996530376 5:124521698-124521720 GCCGCTCTGAGTGTGGGCCGCGG - Intergenic
999205849 5:149847358-149847380 GCCACTATGAGTGGGCACCGTGG - Intronic
1004131797 6:12927929-12927951 GCACCTCCGATTGCTGACCGTGG + Intronic
1007631563 6:43275862-43275884 GCCCCTCCGAGCGGGGAGCGGGG - Intronic
1011640480 6:89412352-89412374 GCCCCGCCGAGTGGTGCCCGCGG - Intergenic
1012427406 6:99129581-99129603 GCTCCTCCAAGTGGGGTCTGAGG - Intergenic
1013174920 6:107668885-107668907 GCCCCTCTGAGAGGGGAACCAGG + Intergenic
1016010871 6:139135885-139135907 GCCCCTCAGAGTGTGGGGCGCGG - Intronic
1018394926 6:163370839-163370861 TCCCCCCAGAGTGGGGACCTGGG - Intergenic
1018779258 6:167046979-167047001 ACCCCTAGGAGTGGGGACCATGG + Exonic
1019352887 7:563215-563237 GACCCTCAGGGTGGGGGCCGAGG - Intronic
1026479579 7:70766155-70766177 GCCTCTCAGAGTGCTGACCGCGG + Exonic
1027052288 7:75027933-75027955 GCCCCTCCAAGTGGGGTCTGGGG - Intronic
1028121476 7:87059893-87059915 GCCCCTCCCAGTGGGCCACGGGG - Intergenic
1034147432 7:148884855-148884877 GCCGCTCCTAGTGGTGCCCGGGG + Intergenic
1035169277 7:157008966-157008988 GCCCCTCCAAGGTGGGGCCGAGG - Intronic
1035781922 8:2234294-2234316 CCCCCTCCGAGAGGTGACAGAGG - Intergenic
1035848902 8:2894217-2894239 GCCCCTCGGAGTTGGGGCCCTGG - Intergenic
1036723513 8:11200330-11200352 GCCCCGCCGAGTGCGAAGCGGGG + Intronic
1038644801 8:29352315-29352337 GCTCATCCGAGTAGGGCCCGGGG - Intergenic
1040946705 8:52892773-52892795 GCCCCTCAGCGTGGTGACCCTGG - Intergenic
1049597218 8:143490240-143490262 GGCCCTCAGAGATGGGACCGTGG - Intronic
1049734616 8:144198298-144198320 ACACCTGCGAGTGGGGACCTAGG + Intronic
1049799017 8:144509248-144509270 TCCCCTCCGCGTGGGGTCAGAGG - Exonic
1050552217 9:6758272-6758294 CCCCCTCCGCGTGGGGCACGGGG + Intronic
1050828132 9:9975475-9975497 GCCACTCTGAGTGAGGACCTAGG + Intronic
1058483955 9:105424412-105424434 GCCCCTCCTAGTGTGGGCTGGGG + Intronic
1059469628 9:114494962-114494984 GCTCCTCAGGGTGGGGACAGCGG + Intronic
1060530889 9:124346503-124346525 GCCCCTCCGGGGGGGAACCGGGG + Intronic
1061224281 9:129271703-129271725 GCCCCTCTGCCTGGGGACTGGGG + Intergenic
1061809899 9:133156147-133156169 GCCCCTGCGGGTGGGCACCCAGG + Intronic
1062279651 9:135746318-135746340 GCCCCTCGGTGAGGGGACCAGGG + Intronic
1190264935 X:48822707-48822729 GCCCCTGATAGTGGGGGCCGTGG - Exonic
1192194311 X:69018414-69018436 GGCCCTCAGAGTGGGGAACCTGG - Intergenic
1199629041 X:149763225-149763247 GCCCCTCTATGTGGGGACGGTGG + Intergenic
1200053955 X:153449018-153449040 GCCCGGCCCAGTGGCGACCGTGG + Intronic
1201499594 Y:14627564-14627586 GCCACTCCGAGTGCTGCCCGCGG + Intronic