ID: 1160242285

View in Genome Browser
Species Human (GRCh38)
Location 18:77132560-77132582
Sequence CGTCCCCGAGGGTCACCCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160242274_1160242285 23 Left 1160242274 18:77132514-77132536 CCCCACTCGGAGGGGCACAGAGA 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG 0: 1
1: 0
2: 2
3: 11
4: 65
1160242273_1160242285 30 Left 1160242273 18:77132507-77132529 CCGCGGTCCCCACTCGGAGGGGC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG 0: 1
1: 0
2: 2
3: 11
4: 65
1160242275_1160242285 22 Left 1160242275 18:77132515-77132537 CCCACTCGGAGGGGCACAGAGAC 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG 0: 1
1: 0
2: 2
3: 11
4: 65
1160242276_1160242285 21 Left 1160242276 18:77132516-77132538 CCACTCGGAGGGGCACAGAGACA 0: 1
1: 1
2: 4
3: 23
4: 201
Right 1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG 0: 1
1: 0
2: 2
3: 11
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160242285 Original CRISPR CGTCCCCGAGGGTCACCCAC CGG Exonic
905529789 1:38668722-38668744 CTTCCCTGATAGTCACCCACAGG + Intergenic
911982833 1:104587139-104587161 CATCCCAGAGGAGCACCCACTGG - Intergenic
921976418 1:221207661-221207683 CATCCCAGAGGGGCACCCACTGG - Intergenic
923040612 1:230317572-230317594 CCTCCCCAAGGGTCAGCCCCCGG - Intergenic
924268294 1:242305279-242305301 CCTGCCCCAGGGTCACCAACTGG + Intronic
1063120340 10:3101463-3101485 CGTCCCCGCCGATCACACACAGG - Exonic
1064290080 10:14025823-14025845 TGTCCTCAAGGTTCACCCACGGG + Intronic
1064347739 10:14548266-14548288 CGCACCCGAGGGTCAACAACTGG + Intronic
1066716612 10:38293470-38293492 CCTGCCCCAGGGTCACCAACTGG - Intergenic
1068951654 10:62783070-62783092 CGTCCCAGAGGGGCACCTGCCGG - Intergenic
1069820992 10:71228729-71228751 AGCACCCGAGGGGCACCCACGGG + Intronic
1073100441 10:101003724-101003746 CGTCCCTGATGGGCAGCCACTGG - Exonic
1076498272 10:130913814-130913836 CTTCCCTGAGGGCCACCCACTGG - Intergenic
1076919545 10:133444592-133444614 GGTCCCCCAGGGTCTCCCACAGG + Intergenic
1079430948 11:20387835-20387857 TGTCCCGGAGGGTCTTCCACCGG - Intronic
1092703338 12:11257095-11257117 TGTCCCAGAGGGGCACCCAGCGG - Intergenic
1095355606 12:41269832-41269854 CTTCCCCAAGGATAACCCACAGG - Intronic
1112229094 13:97569774-97569796 CGTCCCTGAGGATCACTCACTGG - Intergenic
1117104355 14:52382915-52382937 CATCCCAGAGGGGCACCCACTGG - Intergenic
1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG + Intronic
1117920236 14:60721530-60721552 CGTCTGCGAGGGTGACTCACCGG + Intronic
1122788026 14:104172891-104172913 CGTCCCCGGGGGCCAACCAGGGG - Intronic
1122881407 14:104692077-104692099 AGTCCCCGAGGGCCAGCCTCAGG + Intronic
1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG + Exonic
1137729497 16:50679453-50679475 GGTCCCTGAGGGCCGCCCACTGG - Intronic
1141201259 16:81900226-81900248 CTTCACCCAGGGTCACCAACAGG - Intronic
1150624884 17:66835290-66835312 CGTCCCCCAGGGACCCCCCCAGG - Intronic
1156513477 18:37660875-37660897 CATCCCCGGGTGTCACCCTCAGG + Intergenic
1158530492 18:58256074-58256096 CCTCGCCGAGGGACACCCCCGGG + Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
926397014 2:12453917-12453939 CCTCCCCGAGGCTCCCCCGCCGG - Intergenic
927156534 2:20224431-20224453 CATCCCCCCGGGTCACCGACGGG + Intronic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
936262347 2:110972475-110972497 CGGTCCCCAGGGTCACCCCCAGG + Intronic
940054455 2:149499591-149499613 CATCCCAGAGGGGCACCCACCGG + Intergenic
945533682 2:210986594-210986616 CGTCCCAGAGGGGCACCTGCCGG + Intergenic
948350821 2:237339533-237339555 AATCCCCCAGGTTCACCCACAGG - Intronic
948355260 2:237372627-237372649 GGGACCCGAGGGTCAGCCACTGG + Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1177763849 21:25434218-25434240 CCTCCCAGAGGGGCACCCACTGG - Intergenic
1178508240 21:33180513-33180535 CCTTCCCCAGGGTCACACACTGG - Intergenic
1178508285 21:33180724-33180746 CCTTCCCCAGGGTCACACACCGG - Intergenic
1178508308 21:33180821-33180843 CCTACCCCAGGGTCACACACCGG - Intergenic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
950103769 3:10375462-10375484 CGTGCCCGAGGGGCTCCCTCTGG - Exonic
950415676 3:12867776-12867798 CTACCCCGAGGGTCAGCCCCGGG + Intronic
966905806 3:184525397-184525419 AGTCCCCGAGGATCACCTGCGGG - Intronic
977500344 4:97829136-97829158 CGTCCCAGAGGGGCACCCACCGG - Intronic
978313359 4:107410054-107410076 CGTCCGAGAGTGGCACCCACCGG - Intergenic
978865537 4:113505197-113505219 AGTCTCCGATGGTCACACACAGG + Intronic
988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG + Intronic
993860093 5:93125506-93125528 CACCCCCGAGCGTCACCAACTGG + Intergenic
997485158 5:134225450-134225472 CGTCCCTGACGATGACCCACAGG + Intronic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1013964295 6:115936105-115936127 CGTCCCAGAGGGGCACCCACTGG - Exonic
1014569124 6:122986954-122986976 CGTCCCAGAGAGGCACCCGCCGG - Intergenic
1017819741 6:158040789-158040811 CGTCACTCAGGGTCACCCTCTGG + Intronic
1019306613 7:338487-338509 AGTCCCAGAGGGACACCCAGAGG - Intergenic
1019334642 7:477190-477212 CTTCTCCCAGGGGCACCCACCGG - Intergenic
1020272889 7:6607496-6607518 CGTCCCCGAGGGGGCCGCACCGG + Intronic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1034760765 7:153669615-153669637 GCTCCCCGAGGGTCACTCACAGG + Intergenic
1035729175 8:1842507-1842529 GGTCCCTGAGTGTCACCCACAGG - Intronic
1036604274 8:10292557-10292579 CCTCCCCTGGGGTCCCCCACCGG - Intronic
1044293875 8:90504551-90504573 TGACCCCGAGGGTCAACCAAGGG + Intergenic
1049096032 8:140548674-140548696 CATGCCAGGGGGTCACCCACAGG - Intronic
1051629313 9:19127589-19127611 CGTGCCCGAGGGTGACACTCGGG - Intronic
1055865046 9:80803087-80803109 CTTCCCTGGGGGTCACCCATTGG - Intergenic
1056583833 9:87915127-87915149 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056584325 9:87918596-87918618 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056612544 9:88134326-88134348 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1056613036 9:88137794-88137816 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1059374609 9:113872531-113872553 GGTCCGGGAGGGACACCCACAGG - Intergenic
1062324717 9:136006428-136006450 GGTCCCCCAGGGGCACCCTCAGG - Intergenic
1186773231 X:12838733-12838755 CATCCCAGAGGGGCACTCACTGG + Intergenic
1187728422 X:22228017-22228039 TGACCCTGAGGGTCCCCCACAGG - Intronic
1189309783 X:40011134-40011156 CTTCCCCTAGGGCAACCCACGGG - Intergenic
1190699472 X:52976045-52976067 TGCCCCCGAGGGTCACTGACTGG + Intronic
1193382077 X:80827548-80827570 CCTCCCAGAGGGGCACCCACCGG + Intergenic