ID: 1160242668

View in Genome Browser
Species Human (GRCh38)
Location 18:77134063-77134085
Sequence AGCTGCCCTAGGAGCACGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160242657_1160242668 24 Left 1160242657 18:77134016-77134038 CCTCACTTTAAGTCAAGGATGAG No data
Right 1160242668 18:77134063-77134085 AGCTGCCCTAGGAGCACGGGTGG No data
1160242655_1160242668 30 Left 1160242655 18:77134010-77134032 CCACAACCTCACTTTAAGTCAAG No data
Right 1160242668 18:77134063-77134085 AGCTGCCCTAGGAGCACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160242668 Original CRISPR AGCTGCCCTAGGAGCACGGG TGG Intergenic