ID: 1160244302

View in Genome Browser
Species Human (GRCh38)
Location 18:77144889-77144911
Sequence ACCTGATGGGAGGTGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160244293_1160244302 11 Left 1160244293 18:77144855-77144877 CCTCTCCAGAAAGAATGACTTTC No data
Right 1160244302 18:77144889-77144911 ACCTGATGGGAGGTGCATGGGGG No data
1160244295_1160244302 6 Left 1160244295 18:77144860-77144882 CCAGAAAGAATGACTTTCAAGGA No data
Right 1160244302 18:77144889-77144911 ACCTGATGGGAGGTGCATGGGGG No data
1160244292_1160244302 20 Left 1160244292 18:77144846-77144868 CCAGCTGAACCTCTCCAGAAAGA No data
Right 1160244302 18:77144889-77144911 ACCTGATGGGAGGTGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160244302 Original CRISPR ACCTGATGGGAGGTGCATGG GGG Intergenic
No off target data available for this crispr