ID: 1160244461

View in Genome Browser
Species Human (GRCh38)
Location 18:77145843-77145865
Sequence CAGGAGGCCCGGCCCTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160244461_1160244469 27 Left 1160244461 18:77145843-77145865 CCGTGTGAGGGCCGGGCCTCCTG No data
Right 1160244469 18:77145893-77145915 TGTGTTCCTCAGTGTCTTCCCGG No data
1160244461_1160244467 1 Left 1160244461 18:77145843-77145865 CCGTGTGAGGGCCGGGCCTCCTG No data
Right 1160244467 18:77145867-77145889 GCTCAGCCTCTGCAACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160244461 Original CRISPR CAGGAGGCCCGGCCCTCACA CGG (reversed) Intergenic
No off target data available for this crispr