ID: 1160246317

View in Genome Browser
Species Human (GRCh38)
Location 18:77162965-77162987
Sequence CTCAAGGAGCACCCTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160246317_1160246324 10 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246324 18:77162998-77163020 GGTTTTCCCTGCCTCTGGATGGG No data
1160246317_1160246323 9 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246323 18:77162997-77163019 AGGTTTTCCCTGCCTCTGGATGG No data
1160246317_1160246330 26 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246330 18:77163014-77163036 GGATGGGGGACTGATGATCTTGG No data
1160246317_1160246325 11 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246325 18:77162999-77163021 GTTTTCCCTGCCTCTGGATGGGG No data
1160246317_1160246322 5 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246322 18:77162993-77163015 ACTGAGGTTTTCCCTGCCTCTGG No data
1160246317_1160246326 12 Left 1160246317 18:77162965-77162987 CCTGGAGTAGGGTGCTCCTTGAG No data
Right 1160246326 18:77163000-77163022 TTTTCCCTGCCTCTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160246317 Original CRISPR CTCAAGGAGCACCCTACTCC AGG (reversed) Intergenic
No off target data available for this crispr