ID: 1160247802

View in Genome Browser
Species Human (GRCh38)
Location 18:77173514-77173536
Sequence GTGACAGCTGCGTAGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160247797_1160247802 -6 Left 1160247797 18:77173497-77173519 CCGATTGCTATAAAACCGTGACA No data
Right 1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG No data
1160247794_1160247802 16 Left 1160247794 18:77173475-77173497 CCACCACCTGTTCTCATAATAGC No data
Right 1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG No data
1160247796_1160247802 10 Left 1160247796 18:77173481-77173503 CCTGTTCTCATAATAGCCGATTG No data
Right 1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG No data
1160247793_1160247802 19 Left 1160247793 18:77173472-77173494 CCACCACCACCTGTTCTCATAAT No data
Right 1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG No data
1160247795_1160247802 13 Left 1160247795 18:77173478-77173500 CCACCTGTTCTCATAATAGCCGA No data
Right 1160247802 18:77173514-77173536 GTGACAGCTGCGTAGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160247802 Original CRISPR GTGACAGCTGCGTAGGCCCG GGG Intergenic
No off target data available for this crispr